ID: 936508556

View in Genome Browser
Species Human (GRCh38)
Location 2:113127699-113127721
Sequence TGGATTTTCTCCCAGAGGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936508556_936508568 28 Left 936508556 2:113127699-113127721 CCGACCCTCTGGGAGAAAATCCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 936508568 2:113127750-113127772 CCCCAAGGAGGAGAAGGTGAGGG 0: 1
1: 0
2: 6
3: 47
4: 457
936508556_936508566 27 Left 936508556 2:113127699-113127721 CCGACCCTCTGGGAGAAAATCCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 936508566 2:113127749-113127771 ACCCCAAGGAGGAGAAGGTGAGG 0: 1
1: 0
2: 6
3: 36
4: 387
936508556_936508564 16 Left 936508556 2:113127699-113127721 CCGACCCTCTGGGAGAAAATCCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 936508564 2:113127738-113127760 CAGGTAAGGCTACCCCAAGGAGG 0: 1
1: 0
2: 3
3: 20
4: 262
936508556_936508563 13 Left 936508556 2:113127699-113127721 CCGACCCTCTGGGAGAAAATCCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 936508563 2:113127735-113127757 CTTCAGGTAAGGCTACCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 103
936508556_936508565 22 Left 936508556 2:113127699-113127721 CCGACCCTCTGGGAGAAAATCCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 936508565 2:113127744-113127766 AGGCTACCCCAAGGAGGAGAAGG 0: 1
1: 0
2: 1
3: 27
4: 215
936508556_936508560 -3 Left 936508556 2:113127699-113127721 CCGACCCTCTGGGAGAAAATCCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 936508560 2:113127719-113127741 CCAGCAAGATGCAAGCCTTCAGG 0: 1
1: 0
2: 1
3: 8
4: 133
936508556_936508561 2 Left 936508556 2:113127699-113127721 CCGACCCTCTGGGAGAAAATCCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 936508561 2:113127724-113127746 AAGATGCAAGCCTTCAGGTAAGG 0: 1
1: 0
2: 0
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936508556 Original CRISPR TGGATTTTCTCCCAGAGGGT CGG (reversed) Exonic
900793264 1:4693121-4693143 TGGATTTTCTCCCAGTTTATGGG + Intronic
902301948 1:15508087-15508109 TGGACTTGCTGTCAGAGGGTAGG - Intronic
905371297 1:37483915-37483937 CGTCTTTTCTCTCAGAGGGTGGG + Exonic
906747846 1:48234113-48234135 TGGAATGTCTCCCAGAGGGAAGG + Intronic
912460572 1:109828280-109828302 TGGATTTGGTCCCTGAGGCTGGG + Intergenic
912799230 1:112710924-112710946 TGGAGGTTCTACCTGAGGGTAGG - Intronic
912812629 1:112805492-112805514 TGGCTGTGCTCCCTGAGGGTGGG + Intergenic
915534386 1:156526218-156526240 TGGCTTTCCTGCCAGATGGTAGG - Exonic
917835688 1:178939707-178939729 GGGATTTTCCCCCTGGGGGTGGG + Intergenic
919775184 1:201189873-201189895 TGGATGTGCTCCGAGAGGGGAGG - Intergenic
921974914 1:221191679-221191701 TTCATTTTCTCCCAGAAGTTTGG - Intergenic
922134679 1:222813495-222813517 TGGGTTTTCTCCCATTGGGAAGG - Intergenic
922607826 1:226901982-226902004 TAGAGTTTCTCCCAGGAGGTAGG + Intronic
923612766 1:235509965-235509987 TGGGTTTTCTCCCTGTTGGTCGG - Intergenic
923994280 1:239474739-239474761 TGGATTTTGTTGCAGAAGGTGGG + Intronic
924392614 1:243580038-243580060 TTGCTTTTCCCCAAGAGGGTGGG + Intronic
1068292051 10:55015984-55016006 TGGATTTTCTCTCTGAAGGATGG - Intronic
1068753416 10:60623097-60623119 TGGGTCTTCCCCCAGAAGGTAGG + Intronic
1073137193 10:101226627-101226649 AGACTTTTCTCTCAGAGGGTGGG + Exonic
1074742486 10:116498945-116498967 TGGAGTTTCCCCCAGAGCTTAGG + Intergenic
1075297824 10:121293574-121293596 TGGATGTGCTCCCAGAGCCTGGG - Intergenic
1078510476 11:11980842-11980864 TGGCTTTTCTCTCTGAGGGGTGG + Intronic
1079115952 11:17640736-17640758 TGGGATTTCTCCCACTGGGTGGG - Exonic
1079528499 11:21419676-21419698 TGGCTTTTCTCTCAAATGGTTGG - Intronic
1081146234 11:39564623-39564645 TCACTTTTCTCCCAGAGGATGGG + Intergenic
1081923121 11:46798144-46798166 TTGAATTTCTCCAAGATGGTTGG + Exonic
1081979853 11:47259468-47259490 TGGATTTGCTGCTAGAGAGTTGG + Intronic
1082776863 11:57252048-57252070 TGCATTCTCTCCCAGAGGTCTGG + Intergenic
1084696306 11:70757616-70757638 TGCATTTTTTCCTAGTGGGTGGG + Intronic
1086055673 11:82643277-82643299 TGGATTTTATCTCAGCAGGTCGG + Intergenic
1086146764 11:83560730-83560752 GGGATTTTCTTCCACAGGGAAGG + Intronic
1087976210 11:104550554-104550576 TGGAGTTTATCACAGTGGGTAGG - Intergenic
1089070277 11:115694633-115694655 TGGATTTTCTCCCACTAGGGAGG + Intergenic
1089751216 11:120652552-120652574 TGGAGTTTCTCCCAGCCAGTGGG + Intronic
1090075742 11:123579066-123579088 AAGCTGTTCTCCCAGAGGGTGGG + Intronic
1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG + Intronic
1092661366 12:10741779-10741801 TAGATTTGTTCCCAGAGGGAGGG - Intergenic
1093626417 12:21353628-21353650 TGGTTTTTTTCCCAGAAGCTTGG + Intronic
1094037036 12:26082381-26082403 TTGATTTTCTCCCAGAAAATTGG + Intergenic
1096484953 12:51973741-51973763 TGGAATTTCTCCCAGAAGAAAGG + Intronic
1098456069 12:70674831-70674853 TGGGTTTTCTCCCAGTGTGATGG + Intronic
1098656166 12:73032620-73032642 AAGATTTTCTCCCACAGTGTGGG + Intergenic
1099830569 12:87837491-87837513 TGTATTTTGTCCCAGAGGTTAGG - Intergenic
1101634847 12:106530705-106530727 AAGATTTTCTCCCAGACTGTGGG + Intronic
1102929744 12:116853044-116853066 GGGACGTTCCCCCAGAGGGTAGG - Intronic
1104306529 12:127615142-127615164 CCGCTTTTCTCCCAGAGGATGGG + Intergenic
1104761825 12:131301245-131301267 TTGATCTTTGCCCAGAGGGTGGG - Intergenic
1104817948 12:131659539-131659561 TTGATCTTTGCCCAGAGGGTCGG + Intergenic
1104934116 12:132355435-132355457 TGGGTGTTTTCCCAAAGGGTGGG - Intergenic
1108252118 13:48577825-48577847 TGACTTTTCTCCCAGAGAGCAGG + Intergenic
1110817963 13:79882392-79882414 TGTATGTTCTCCTAGAGGTTTGG - Intergenic
1114840644 14:26259000-26259022 TTTATTTTCTCCTAGAGGTTGGG - Intergenic
1116697728 14:48199398-48199420 CCGCTTTTCTCCCAGAGGATGGG + Intergenic
1117353227 14:54901474-54901496 CGGCTTTTCACCCAGAGGGTGGG - Intronic
1117714471 14:58566593-58566615 TGGATTTTCTCAAAGAAGCTAGG - Intergenic
1119213397 14:72849708-72849730 TGGCCTTTATCCCAGAGGTTGGG + Intronic
1120994506 14:90406610-90406632 TAGATTTTCTGCCAGAGGGGTGG + Exonic
1122291711 14:100684114-100684136 AGGATTTCCTGCCAGAGGGAAGG + Intergenic
1122305535 14:100763812-100763834 TGGATTTTCTACCACACGGAGGG - Intergenic
1122904441 14:104795429-104795451 TGGATTTCCTCCCCGCGGGCCGG - Intronic
1126148385 15:45499495-45499517 TGGTTTTTTTTCCAGACGGTGGG - Intronic
1127644359 15:60945170-60945192 TGGATTTTCAGAGAGAGGGTGGG - Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1130603260 15:85292536-85292558 TAGATTGTCTCCTACAGGGTTGG + Intergenic
1132180438 15:99748934-99748956 TGGATTTTCCCCTAGGGGGAGGG + Intergenic
1132246252 15:100298435-100298457 TGGGTGCTCTCCCAGAGGGAGGG + Intronic
1132290244 15:100695216-100695238 TGAATTTTAACTCAGAGGGTGGG + Intergenic
1133590141 16:7234293-7234315 TGGTTTATCTTCCAGTGGGTTGG + Intronic
1134817377 16:17216942-17216964 TGGTTTTGCTCCTAGAGGGCAGG + Intronic
1135426608 16:22342324-22342346 AGTATTTTCTCCCAGTGCGTAGG - Intergenic
1136870185 16:33799953-33799975 TGCATTTTCTCTCAAAGGGGTGG - Intergenic
1138768045 16:59627778-59627800 TGGTTATTCTCTCAGAGGGGTGG - Intergenic
1139915955 16:70428599-70428621 TGGATTGTGTCCAAGAGGGAGGG - Intronic
1141382171 16:83586294-83586316 GGGATTTCCTCCCAGAGAGAGGG + Intronic
1141705894 16:85664290-85664312 TCGACTTTCTCCCAGAGAGGAGG - Intronic
1142324989 16:89408995-89409017 TGGTTTTGCTCCCAGAGGCAGGG - Intronic
1203101986 16_KI270728v1_random:1316101-1316123 TGCATTTTCTCTCAAAGGGGTGG + Intergenic
1144256482 17:13473465-13473487 TGGATTTTGGCTTAGAGGGTGGG + Intergenic
1144260903 17:13519730-13519752 TAAATTTTCTCCCAGAGAGTTGG - Intronic
1151925546 17:77193563-77193585 GGGATTTTGTGGCAGAGGGTGGG + Intronic
1152356331 17:79809489-79809511 GGGATTCTCTGCCAGAGGGGCGG - Intergenic
1155475707 18:26234375-26234397 TGGGGGTTCTCCCAGAGGTTGGG + Intronic
1157089409 18:44618599-44618621 TGAATTTTCTCCCACAGAATGGG + Intergenic
1157495975 18:48157890-48157912 TTGAATTTCTCCCACAGGATGGG - Intronic
1158020793 18:52838835-52838857 TCCATTTTCTCCCAAAGTGTTGG - Intronic
1158533742 18:58287852-58287874 TGCTTTTTCTAACAGAGGGTGGG + Intronic
1159996694 18:74971308-74971330 TTGAATTTCTCCCAGAAAGTGGG + Intronic
1161542680 19:4861450-4861472 TGGACTTTCTCCTGGAAGGTGGG - Intronic
1162192404 19:8957245-8957267 TGGTTTTTTCCACAGAGGGTGGG + Exonic
1162237072 19:9317785-9317807 TTACTTTTCTCCCAGAGGATGGG - Intergenic
1165187333 19:34033279-34033301 TGGCTTTTCTCCCAGCAGCTTGG + Intergenic
1166255137 19:41599015-41599037 TGGATTTACTCCCAGCAGGGAGG - Intronic
1166293336 19:41877287-41877309 GGCATCTTCTCCCAGTGGGTTGG - Exonic
924962898 2:49583-49605 TGGATTTTCTTCCAGTTAGTAGG - Intergenic
925174094 2:1770285-1770307 TGCATACTCTCCAAGAGGGTGGG - Intergenic
925975771 2:9140996-9141018 TGGACTTTCTCCTACATGGTCGG - Intergenic
927207937 2:20621756-20621778 TGGATTTGCTCCCAGGTGGGTGG + Intronic
927738669 2:25546587-25546609 TGGATTTAGCCCCAGAGGTTAGG - Intronic
930099354 2:47590982-47591004 TGGATCTTCTCACAGAGTGAGGG + Intergenic
933247882 2:79995968-79995990 TGAATTGTTTCCAAGAGGGTTGG - Intronic
935659813 2:105456543-105456565 TGCATTTTCTCCAAATGGGTGGG - Intergenic
935793550 2:106616790-106616812 AGTATTTTCTCCCAGACGGTGGG + Intergenic
935802495 2:106712893-106712915 TGCATTTTTTCCCATAGGTTAGG + Intergenic
936508556 2:113127699-113127721 TGGATTTTCTCCCAGAGGGTCGG - Exonic
942596225 2:177593982-177594004 GGGTTTTTCTCCCTGAGTGTGGG + Intergenic
943848177 2:192678661-192678683 TGGATTTTTTTCATGAGGGTAGG + Intergenic
947163649 2:227239881-227239903 TTGACTTTCTCCCAAATGGTAGG - Intronic
1169297239 20:4410720-4410742 TGGATTTTTTCCCACAGGTATGG - Intergenic
1171261763 20:23740239-23740261 TGGGGGTTCTCCCAGAGGTTAGG - Intergenic
1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG + Intergenic
1173579477 20:44137153-44137175 CGGATTTTCTCCCCAAGGGTTGG + Intronic
1175017736 20:55809974-55809996 TTCATTTTATCCCGGAGGGTGGG + Intergenic
1176134597 20:63516560-63516582 TGGATTTTATCCTAAAGTGTAGG + Intergenic
1176547270 21:8207386-8207408 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
1176555175 21:8251595-8251617 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
1176566221 21:8390433-8390455 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
1176574095 21:8434619-8434641 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
1180862346 22:19092096-19092118 TGGATCATCTCCCAAAGTGTTGG - Intronic
1181960728 22:26619842-26619864 TGGGCTGTCTGCCAGAGGGTGGG + Intergenic
1184184966 22:42858180-42858202 GGAATTGTTTCCCAGAGGGTAGG - Intronic
1184422778 22:44391542-44391564 CGGATGTTCTCCCAGGGGGCTGG - Intergenic
1203252143 22_KI270733v1_random:123671-123693 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
1203260197 22_KI270733v1_random:168754-168776 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
955127643 3:56129647-56129669 TGTATTTTCTCACAGACGATTGG + Intronic
959281503 3:104347496-104347518 TGAGTTTGCTCCCAGAGGGGAGG + Intergenic
960997377 3:123349015-123349037 TGGACTTACTCCCAGAGTGCAGG - Intronic
961383407 3:126510324-126510346 TTGTTTTTCTGCCAGAGGGCAGG - Intronic
962244002 3:133776291-133776313 TGGTTGTTCCCCCAGAGGGCAGG - Intronic
962425332 3:135264413-135264435 TGGTTCTGCTCTCAGAGGGTTGG - Intergenic
963408994 3:144905882-144905904 CCGCTTCTCTCCCAGAGGGTGGG - Intergenic
966543341 3:181116547-181116569 TGTATTTTTTTCCAGAGGGATGG + Intergenic
967584019 3:191190647-191190669 CCAATTTTCTCCCAGAGGATGGG + Intergenic
968135526 3:196217113-196217135 TGGATTCTCTCCATGCGGGTCGG - Intronic
972031159 4:34459953-34459975 AGTATTTTATCCCAGTGGGTGGG + Intergenic
972601166 4:40574178-40574200 TAAATATTCTCCCAGAGTGTAGG + Intronic
974838458 4:67277024-67277046 TGGGGTTTCCCCCAGAGGTTAGG + Intergenic
975967521 4:79992368-79992390 TGTATTTTTTCCCTGAGGTTTGG - Intronic
979912282 4:126382416-126382438 TGTTGTTTCTCCCTGAGGGTGGG - Intergenic
980092759 4:128459574-128459596 GGCAGTTTCTCCCAGAGGGCTGG + Intergenic
980302851 4:131015816-131015838 TGCAGATTCTCTCAGAGGGTGGG + Intergenic
980585242 4:134805427-134805449 TGAATTTTCAGCCAGTGGGTTGG + Intergenic
981780711 4:148426326-148426348 GTGGTTTTCTACCAGAGGGTTGG - Intronic
985175896 4:187200486-187200508 TGTATATTTTTCCAGAGGGTTGG + Intergenic
985344781 4:188992359-188992381 TGGTTTTTCTCCGAAAGGGAGGG - Intergenic
986603947 5:9502920-9502942 TGGATATTTTCCCAAAGGGATGG + Intronic
990367607 5:55086852-55086874 TGGAGGTTCCCCCAGAGGTTAGG + Intergenic
993017493 5:82551689-82551711 GTGATTTTCTCACAAAGGGTAGG - Intergenic
994302179 5:98159308-98159330 TTGATTAGCTCCCTGAGGGTTGG - Intergenic
994576434 5:101585637-101585659 TGGAATTTCTCCCAGAAAATGGG - Intergenic
994651039 5:102528808-102528830 TGAATTATCTCCCAGAGGAAAGG + Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
999075685 5:148793199-148793221 TGGATTTGGACCCAGAGAGTCGG - Intergenic
1000185530 5:158854400-158854422 TTGATTTTCTCCCAGACCTTTGG + Intronic
1005716626 6:28555373-28555395 TTTATTTACTCCCAGAGTGTGGG - Intergenic
1007360774 6:41353628-41353650 TGGCATTTCTCCCAGAAGCTTGG - Intergenic
1007599831 6:43074960-43074982 TGGCTTTTCAGTCAGAGGGTTGG + Exonic
1008869811 6:56260015-56260037 TAGATTCTAACCCAGAGGGTAGG + Intronic
1012441204 6:99263923-99263945 CTGTTTTTCTCCCAGAGGATGGG - Intergenic
1018762478 6:166904111-166904133 TGGACTTTCTGCCAGAAGGTCGG + Intronic
1020825363 7:13020752-13020774 TGAATTTTCTCCCAGAAGAAGGG - Intergenic
1023664062 7:42501900-42501922 TGAAATTTCTCTCAGGGGGTGGG + Intergenic
1025269806 7:57499467-57499489 AGTATTTTATCCCAGTGGGTGGG - Intergenic
1027711071 7:81601872-81601894 TGGATTAGTTTCCAGAGGGTAGG + Intergenic
1029147337 7:98455744-98455766 TGCATTTCCTCCCAGAAGTTGGG - Intergenic
1030420650 7:109302686-109302708 TGGAGGTTCCCCCAGAGGTTAGG - Intergenic
1032391906 7:131560719-131560741 TGGATTTTCTCTCCAAGGTTGGG + Intergenic
1034464143 7:151215863-151215885 TGGAATTCCTGCCAGGGGGTGGG + Intronic
1036508021 8:9373694-9373716 TGTATATCCTCCCAGGGGGTAGG - Intergenic
1036927469 8:12920904-12920926 TGAATTTTCCCCCAGAGCCTCGG - Intergenic
1039447336 8:37643251-37643273 TGCATTTTCACCCAGAGATTGGG + Intergenic
1041002252 8:53464498-53464520 CCAATTTTCTCCCAGAGGATGGG + Intergenic
1042799806 8:72706344-72706366 TGGATTTTGGCTCAGAGTGTTGG + Intronic
1049495722 8:142931307-142931329 TGAATTGTCTCCCTGAGGGCTGG - Intergenic
1053252897 9:36589887-36589909 AGAATTTTCTCCTAGAGGGAAGG + Intronic
1055728472 9:79257264-79257286 GGGTTTATCTCCCAGAGGGCTGG - Intergenic
1060253202 9:122002606-122002628 TGGATGTTTTCCCAGGGGATGGG - Intronic
1060331356 9:122673822-122673844 TGGATTATCAGCCAGAGAGTAGG + Intergenic
1061230943 9:129315520-129315542 TGGAATTTATCCCAGGGGGCTGG - Intergenic
1203468546 Un_GL000220v1:106821-106843 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
1203476367 Un_GL000220v1:150793-150815 AGGCTTTTCTCACCGAGGGTGGG - Intergenic
1186092460 X:6064434-6064456 TGGAAATTCTCCCAGCGGGCGGG - Intronic
1187021666 X:15388978-15389000 TGGATCCTCTCCCAGTGGCTTGG - Intronic
1187407238 X:19015077-19015099 TGGATCTTGTGCCAGAGAGTAGG - Intronic
1187695037 X:21911147-21911169 GGGAATTCCTCCCAGAGGGCAGG + Intergenic
1189905148 X:45751285-45751307 AGGGTTTTCTTCCAGAGTGTGGG - Intergenic
1190435556 X:50421242-50421264 TTGATCTTTTCCCAGAGGGCAGG + Intronic
1190783715 X:53623291-53623313 TGGACTTTCTCCCAGAAGACGGG + Intronic
1191200749 X:57778739-57778761 TGGATTTTCTCCCATTCTGTAGG + Intergenic
1191254138 X:58272580-58272602 TGGGGTTCCTCCCAGAGGTTAGG - Intergenic
1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG + Intergenic
1195439947 X:104888035-104888057 TGGGCTTTCTCCTAGAGGTTAGG - Intronic
1196561335 X:117152678-117152700 GAGATTTTCTTCCTGAGGGTTGG + Intergenic
1200839466 Y:7765735-7765757 TGGTTTGTCTCCCAGAGAGCTGG - Intergenic
1201271820 Y:12263221-12263243 TGGGTCTTCCCCCAGAGGTTAGG + Intergenic
1201407229 Y:13661457-13661479 TGACTTTTCTCCCAGAGGATGGG - Intergenic
1202258205 Y:22942222-22942244 CCGCTTTTCTCCCAGAGGATGGG + Intergenic
1202411195 Y:24575980-24576002 CCGCTTTTCTCCCAGAGGATGGG + Intergenic
1202459586 Y:25094092-25094114 CCGCTTTTCTCCCAGAGGATGGG - Intergenic