ID: 936511403

View in Genome Browser
Species Human (GRCh38)
Location 2:113150406-113150428
Sequence AGGGATAGTGCAGTGATTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936511403_936511408 22 Left 936511403 2:113150406-113150428 CCGGCAATCACTGCACTATCCCT No data
Right 936511408 2:113150451-113150473 GATTCTCTCCCTGTGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936511403 Original CRISPR AGGGATAGTGCAGTGATTGC CGG (reversed) Intergenic
No off target data available for this crispr