ID: 936513482

View in Genome Browser
Species Human (GRCh38)
Location 2:113167286-113167308
Sequence GTGGACAGACGGCCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936513482_936513493 16 Left 936513482 2:113167286-113167308 CCTGTCCCTGGCCGTCTGTCCAC 0: 1
1: 0
2: 0
3: 24
4: 255
Right 936513493 2:113167325-113167347 TCATTTGACTGGCCACGGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
936513482_936513489 5 Left 936513482 2:113167286-113167308 CCTGTCCCTGGCCGTCTGTCCAC 0: 1
1: 0
2: 0
3: 24
4: 255
Right 936513489 2:113167314-113167336 CTGGGTGTGCTTCATTTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 99
936513482_936513490 11 Left 936513482 2:113167286-113167308 CCTGTCCCTGGCCGTCTGTCCAC 0: 1
1: 0
2: 0
3: 24
4: 255
Right 936513490 2:113167320-113167342 GTGCTTCATTTGACTGGCCACGG 0: 1
1: 0
2: 1
3: 9
4: 121
936513482_936513491 12 Left 936513482 2:113167286-113167308 CCTGTCCCTGGCCGTCTGTCCAC 0: 1
1: 0
2: 0
3: 24
4: 255
Right 936513491 2:113167321-113167343 TGCTTCATTTGACTGGCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 110
936513482_936513492 15 Left 936513482 2:113167286-113167308 CCTGTCCCTGGCCGTCTGTCCAC 0: 1
1: 0
2: 0
3: 24
4: 255
Right 936513492 2:113167324-113167346 TTCATTTGACTGGCCACGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 64
936513482_936513494 21 Left 936513482 2:113167286-113167308 CCTGTCCCTGGCCGTCTGTCCAC 0: 1
1: 0
2: 0
3: 24
4: 255
Right 936513494 2:113167330-113167352 TGACTGGCCACGGGCGGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936513482 Original CRISPR GTGGACAGACGGCCAGGGAC AGG (reversed) Intronic
900192968 1:1359148-1359170 CTGGAGAGTCAGCCAGGGACAGG + Intronic
900457913 1:2786284-2786306 ATGGACACACAGCCAGGGGCTGG - Intronic
900513652 1:3071438-3071460 GTGGACAGAGGGCCGAGGCCTGG - Intronic
900525536 1:3126610-3126632 GTGGGCAGAGGGCTGGGGACTGG + Intronic
901150910 1:7100677-7100699 GTGGACAGGAGGCCAGCGCCGGG - Intronic
901680356 1:10909529-10909551 GGGGACAGAGGGTCAGGGAGTGG - Intergenic
901829556 1:11883727-11883749 GTGGGCAGGCAGCCAGGGACAGG + Intergenic
902569160 1:17335873-17335895 GTGGCCAGACGTGCAGGGTCTGG + Intronic
902675479 1:18005756-18005778 ATGGAGAGAAGGCCAGGGAGAGG + Intergenic
902962681 1:19976036-19976058 GTGGAGACACAGCCAGGCACTGG + Intronic
903172822 1:21564227-21564249 GGGGGCAGCCGGGCAGGGACGGG + Intronic
903305674 1:22411376-22411398 GTTGACACAGGGCCAGGGCCGGG + Intergenic
903624670 1:24721863-24721885 GTGGGCACACGGCACGGGACCGG + Intergenic
905037890 1:34929517-34929539 TTGGGCAGGCGGGCAGGGACCGG + Exonic
905889213 1:41509301-41509323 GTGGAGACAGGGGCAGGGACGGG + Exonic
909189913 1:72538921-72538943 CTGGACAGAATGCCAGGGGCCGG - Intergenic
912146385 1:106799084-106799106 GTGGGCAGGGGGCCAGGGAATGG + Intergenic
914349795 1:146831255-146831277 AGGGACAGAGGGCCAGGGATGGG - Intergenic
915495900 1:156282545-156282567 GTGGGGAGACGGCGAGGGGCGGG - Intronic
915914203 1:159931422-159931444 CTGGAGAGAGGGCCAGGGGCTGG - Intronic
919882467 1:201909574-201909596 GTGGACTGGCGACCAGGGATGGG - Intronic
922878967 1:228964787-228964809 GAGGACAGACGGCCAGGCCTGGG + Intergenic
923858216 1:237867351-237867373 ATGGACAGATGGACAAGGACAGG - Intergenic
1063460601 10:6212919-6212941 GGGGACAGAGGGGCAGGGGCTGG - Intronic
1064424909 10:15222058-15222080 GTGGGCAGAAGGCCAGGGAGAGG + Intronic
1065055173 10:21836894-21836916 GTGGAGAGACGGAGAGGGAGAGG - Intronic
1065430895 10:25654364-25654386 GCAGACAGGAGGCCAGGGACTGG + Intergenic
1067254156 10:44618997-44619019 GTGGACAGATGGGGAGGGAAGGG - Intergenic
1071020004 10:81042020-81042042 GTGGACAGATGGCTGGTGACTGG + Intergenic
1073186085 10:101615771-101615793 CTGGATAGCCCGCCAGGGACAGG + Intronic
1073751139 10:106528145-106528167 CTGGGCACACGGGCAGGGACTGG - Intergenic
1075242212 10:120789455-120789477 GGGGCCAGAAGGCCAGGAACGGG - Intergenic
1075314027 10:121437845-121437867 GTGGGCAGAGGGCCAGAGGCAGG - Intergenic
1076768758 10:132651555-132651577 GGGGACAGAAGGCCAGAGATGGG - Intronic
1077582580 11:3426281-3426303 GTAGAAAGAGGGCCAGGCACGGG + Intergenic
1078746207 11:14117834-14117856 GTGGACACACTGCCAGGGAGTGG - Intronic
1083955565 11:65981135-65981157 TTGGACAGTAGGCCAGGGCCTGG - Intergenic
1084192367 11:67504886-67504908 GTGGAGAGCCGGCGAGGGCCAGG - Intronic
1084239484 11:67809105-67809127 GTAGAAAGAGGGCCAGGCACGGG + Intergenic
1086017040 11:82181186-82181208 GTGGAAAGACGGAGAGGGAGAGG - Intergenic
1087807056 11:102566410-102566432 GTGGGCAGAGGGCTAGGGAATGG - Intergenic
1088054348 11:105557088-105557110 GTGGACAGCAGGCTAGGGAATGG + Intergenic
1088392924 11:109335124-109335146 GTGAACAGACGGGCAGAGACAGG + Intergenic
1089540403 11:119186316-119186338 GTGGGCAGAGGGACTGGGACAGG - Intronic
1090173922 11:124630894-124630916 GTGATCATCCGGCCAGGGACTGG + Intronic
1090381072 11:126328198-126328220 GTGGAAAGAGGGCCAGGGCGAGG + Intronic
1091201273 11:133782680-133782702 GTGGGCACACGGCGCGGGACTGG + Intergenic
1091333374 11:134748665-134748687 GTGGGCAGAGGGCTAGGGAATGG + Intergenic
1092839758 12:12528388-12528410 GAGGAAATACGGCCAGGGATTGG + Intronic
1093032240 12:14298776-14298798 GTGGAAAGACGGCCTGGGCCAGG + Intergenic
1096012879 12:48236331-48236353 GTGCATAGGAGGCCAGGGACTGG - Intergenic
1096386813 12:51199704-51199726 CTGGACAGAAGGCCGGGGGCAGG - Intronic
1096616928 12:52838554-52838576 GCAGCCAGACTGCCAGGGACAGG + Intronic
1099002513 12:77196073-77196095 CTGGACAGATGGGCAGGGAAGGG + Intergenic
1099191464 12:79565335-79565357 GTGGGCACACGGCGTGGGACTGG + Intergenic
1100130472 12:91487032-91487054 GTGGAAACACTGGCAGGGACTGG + Intergenic
1100262250 12:92943344-92943366 GTGGGTAGAGGGCCAGGGAGTGG - Intergenic
1101009063 12:100430683-100430705 GTGGGCACACGGCACGGGACTGG + Intergenic
1101839299 12:108316434-108316456 GAGGAGAGACGCACAGGGACTGG + Intronic
1102192335 12:110998163-110998185 GTGGACAGGGGGCTAGGGAATGG - Intergenic
1104441777 12:128799135-128799157 GTGGACAGGCAGCTCGGGACAGG + Intronic
1104810980 12:131620311-131620333 GTGAGCTGACGGCCAGGGCCGGG - Intergenic
1105428048 13:20312728-20312750 CTGGACAGATGGGCAGGGAGTGG + Intergenic
1108003273 13:45923867-45923889 GTGGGCAGACAGGCAGGGCCAGG - Intergenic
1110617446 13:77556738-77556760 GTGGACAGAAGGGCAGAGAGAGG + Intronic
1112022801 13:95386132-95386154 GTGGGCAGAGGGCTAGGGAATGG - Intergenic
1112788157 13:102974364-102974386 GTGGACAGAAGGACAGAGACGGG - Intergenic
1113105642 13:106769242-106769264 TTGGACAGAAAGGCAGGGACTGG - Intergenic
1114434218 14:22690644-22690666 GTGGACTGACAACCTGGGACAGG - Intergenic
1115920539 14:38367585-38367607 GTGGCCAGACAGCCTCGGACTGG - Intergenic
1119951780 14:78752692-78752714 GTGGATAGAGGCCCAGGGATAGG + Intronic
1120401765 14:84041384-84041406 GTGGGCACAGGGCCAGGGAGTGG + Intergenic
1120838586 14:89063074-89063096 GTGGGCAGAGGGCTAGGGAATGG - Intergenic
1121647118 14:95526070-95526092 GAGGACAGATGGTAAGGGACTGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123117642 14:105901878-105901900 GTGGGCAGACGGCTGTGGACGGG - Intergenic
1125902158 15:43358657-43358679 ATGGCCAGATGGCCAAGGACTGG - Exonic
1126973659 15:54149100-54149122 GGAGACAGAGAGCCAGGGACAGG - Intronic
1127343057 15:58066356-58066378 GTGGCCAGAGGGTCAGGGAGAGG + Exonic
1127582839 15:60353373-60353395 GAGGAGACACAGCCAGGGACAGG - Intronic
1128155925 15:65391963-65391985 TCGTACAGCCGGCCAGGGACTGG + Exonic
1128502107 15:68233823-68233845 AAGGACAGACAGCAAGGGACTGG + Intronic
1129249383 15:74300418-74300440 CTGGACATGCGGCCAGGGAGCGG + Intronic
1130297234 15:82656012-82656034 GTGGATAGAAGCACAGGGACTGG - Intergenic
1130916432 15:88308756-88308778 ATGTACAGACTGCCAGGGGCCGG + Intergenic
1131491780 15:92869250-92869272 GGGGTCAGACAGCCAGGGAATGG + Intergenic
1132372138 15:101306550-101306572 GTAGACACACGGGCAGGGAAGGG - Intronic
1132791224 16:1689840-1689862 GTGGCCAGACTGCCTGGGTCAGG - Intronic
1133278233 16:4650678-4650700 GAGGCCAGATGGCCAGGGGCAGG + Intronic
1133283882 16:4681684-4681706 GGGGACAGCTGGCCTGGGACAGG - Exonic
1133351161 16:5101516-5101538 GTAGAAAGAGGGCCAGGCACGGG + Intergenic
1136028916 16:27488740-27488762 GTGCACTGACAGCCAGGGGCTGG + Intronic
1136061478 16:27729696-27729718 GTGGACAGACAGGCAGGGTTTGG - Intronic
1138496846 16:57414012-57414034 GGGGACAGGTGGCCAGGGGCAGG + Intronic
1139310515 16:66024561-66024583 GTGGGCAGATGGACAGGGAGAGG - Intergenic
1139368796 16:66451950-66451972 GTGAACACAAGGCCTGGGACTGG + Intronic
1139441708 16:66971325-66971347 TTGGGCAGGTGGCCAGGGACAGG - Intronic
1139984241 16:70884276-70884298 AGGGACAGAGGGCCAGGGATGGG + Intronic
1140713890 16:77704566-77704588 GTGGGCAGAGGGCTAGGGAATGG - Intergenic
1141576202 16:84964786-84964808 GTGGCCACACGGTGAGGGACAGG + Intergenic
1142994680 17:3753680-3753702 GTGCACAGTGGGCCAGGGCCCGG - Intronic
1144781616 17:17811072-17811094 GCGGACGGACTGGCAGGGACTGG - Exonic
1146184710 17:30717319-30717341 GTGGACAAAAGGCAAGGGACAGG + Intergenic
1146509737 17:33436589-33436611 GTGGACAGAGGGCTAGGAAATGG - Intronic
1147164467 17:38586061-38586083 CTGGACAGAAGGCCTGAGACAGG + Intronic
1147638033 17:41975762-41975784 GTTCAGAGATGGCCAGGGACAGG - Exonic
1148019205 17:44542328-44542350 GTGGGCAGAAGGCCAGGGTCTGG + Intergenic
1148352311 17:46949955-46949977 GTGTGCAGAGGACCAGGGACTGG - Intronic
1150429268 17:65102250-65102272 GTGGCCAGAGTGCCAGGGAGTGG + Intergenic
1151563794 17:74885688-74885710 AAGGACAGACGGGCAGGGATGGG - Intronic
1151684573 17:75639240-75639262 GGGGACAGGTGGCCAGGGGCTGG - Exonic
1152562361 17:81084953-81084975 GTGGACACACGGCCAAGGTGTGG - Intronic
1152821428 17:82439676-82439698 GCAGGCAGGCGGCCAGGGACGGG - Exonic
1154057170 18:11023628-11023650 GTGGGCACACGGCACGGGACTGG - Intronic
1155172419 18:23276708-23276730 GAGGATAGGCGGGCAGGGACTGG - Intronic
1156425664 18:37009387-37009409 GAGGATAGAGGGCCAGGGAGAGG + Intronic
1156465371 18:37345349-37345371 GTGGAGAGAGGGGCAGGGAGAGG + Intronic
1160680762 19:410870-410892 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680777 19:410907-410929 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680792 19:410944-410966 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680807 19:410981-411003 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680822 19:411018-411040 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680837 19:411055-411077 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680865 19:411129-411151 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680880 19:411166-411188 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680895 19:411203-411225 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680907 19:411240-411262 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680922 19:411277-411299 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160680934 19:411314-411336 GTGGACAGACCCCCAGGATCCGG - Intergenic
1160931067 19:1569656-1569678 TTGCACAGCCAGCCAGGGACAGG - Intergenic
1161060420 19:2211895-2211917 GGGGACAGATGCCCAGGAACAGG - Intronic
1161683823 19:5693496-5693518 GTGGCCAGCAGCCCAGGGACTGG + Intronic
1162741140 19:12774612-12774634 GTGAAGAGATGACCAGGGACGGG - Intronic
1162769891 19:12943046-12943068 ATGGAGAGACAGCCAGGGACGGG - Intronic
1162974071 19:14198374-14198396 GTGGACAAAAGGCAAGGGACAGG - Intronic
1163017840 19:14467648-14467670 GTGGACAGGGGGCCAGGGAGTGG - Intronic
1163585454 19:18161254-18161276 GCGGACAGATGGCCAGGGCAGGG - Intronic
1163641860 19:18466583-18466605 GAGGACGGACAGCCAGGGGCAGG + Intronic
1163715605 19:18870497-18870519 GTGGAGGGGCGGCCAAGGACGGG + Exonic
1165319769 19:35077918-35077940 GTGAACAGGTGGCCAGGGAGAGG - Intergenic
1165371129 19:35406862-35406884 GTGGAGAGATGGTCAGGGCCTGG + Intergenic
1165376764 19:35448552-35448574 GTGGACAGAGGGACAGGACCTGG + Intronic
1166301818 19:41915391-41915413 ACGGACAGACGGACGGGGACAGG - Intronic
1168107654 19:54174272-54174294 GGGGCCAGAAGGCCTGGGACTGG - Exonic
925146907 2:1588009-1588031 GGGGACAGAGGGACAGGGATGGG - Intergenic
925576881 2:5369411-5369433 GTGGGCAGACGACAAGGGAAAGG + Intergenic
927295469 2:21447927-21447949 TTGGAGAGACGGCTAGGAACAGG - Intergenic
928610963 2:32992406-32992428 GTGGACAAAAGCCCAGGGATGGG + Intronic
929575518 2:43049537-43049559 AAGGCCAGACGCCCAGGGACTGG - Intergenic
934551746 2:95267112-95267134 GGGGAGAGACGGCCAGAGGCAGG + Intergenic
936513482 2:113167286-113167308 GTGGACAGACGGCCAGGGACAGG - Intronic
937045806 2:118850888-118850910 GCGCACAGAAGGCCATGGACTGG + Intergenic
937910306 2:127072387-127072409 GCGGACAGAGGGTCAGCGACCGG + Intronic
940064440 2:149611316-149611338 GAGCACAGACTGGCAGGGACAGG + Intergenic
941185725 2:162319078-162319100 GTGGTGAGACTGCGAGGGACAGG + Intronic
941789997 2:169541812-169541834 TTGGAGAGACAGCCAGAGACTGG - Intronic
945280881 2:208034369-208034391 GTGGACAGGAGGCTAGGGAATGG - Intergenic
948642768 2:239385929-239385951 GTAAACAGAGGCCCAGGGACAGG + Intronic
948661401 2:239508831-239508853 GTGGGAAGATGGGCAGGGACCGG - Intergenic
1169021114 20:2331909-2331931 CTGGACAGGCGGCCTAGGACTGG - Intronic
1169270136 20:4192713-4192735 TTGGACACACAGGCAGGGACAGG + Intergenic
1169289106 20:4333317-4333339 GTGGAGAGATGGACAGGCACTGG + Intergenic
1171249169 20:23635694-23635716 GTGGACTGAATGCCAGGAACTGG - Intronic
1172275435 20:33676647-33676669 CTGGGAGGACGGCCAGGGACAGG + Exonic
1172468852 20:35176143-35176165 GTGGATAGACAGTCAGGGTCAGG - Intronic
1172846998 20:37935486-37935508 GTGGAAAGGCTGCCAGGGTCGGG - Intronic
1172948376 20:38705763-38705785 GAGGACAGAATGCCATGGACTGG - Intergenic
1173538473 20:43833460-43833482 GTGCACAGAAGGCCAGGCCCAGG + Intergenic
1174140272 20:48408280-48408302 GTGGAGAGCCAGCCAGGGAAAGG - Intergenic
1175310230 20:58006722-58006744 GTGGACAGATAGCCAGGAATTGG - Intergenic
1175891456 20:62317843-62317865 GTGGACAGCAGGGCAGGGAAGGG + Intronic
1175922603 20:62457161-62457183 GGGGGCAGACAGCCCGGGACTGG + Intergenic
1175971572 20:62689236-62689258 GGACACAGCCGGCCAGGGACAGG - Intergenic
1176038631 20:63052575-63052597 GTGGACAGACAGGCAGGGCCTGG + Intergenic
1177233603 21:18356230-18356252 TTGGAAAGACGGCAATGGACGGG + Intronic
1178293030 21:31386104-31386126 GTGGAGGGGCTGCCAGGGACAGG + Intronic
1180871660 22:19150160-19150182 GTGGGCAGGCGGCCCGGGCCGGG + Exonic
1180902586 22:19385468-19385490 ATGGACATATGCCCAGGGACAGG - Intronic
1180950264 22:19717651-19717673 GTGGACAGAAGGGAAGGGAAGGG - Intronic
1183194010 22:36340807-36340829 GGGGACAGACAGCCAGGGCGAGG + Intronic
1183700058 22:39446103-39446125 GTGGACATGCTGCCAGGGCCGGG + Intergenic
1183829677 22:40411135-40411157 TTGGACACACGGTCAGGGTCAGG - Exonic
1183947407 22:41334463-41334485 GTGAACAGCCTGGCAGGGACTGG - Intronic
1183953758 22:41367357-41367379 GTGGACGGGCGGGCTGGGACTGG + Intronic
1183956321 22:41382365-41382387 GAGGACAGAGGGTCAGGGGCGGG + Intronic
1184943973 22:47788016-47788038 GTGCACAGCCAGCCAGGCACTGG + Intergenic
1184975024 22:48054980-48055002 GTCTCCAGCCGGCCAGGGACCGG - Intergenic
1185110050 22:48895713-48895735 GTGGACACACGGCCAGGACAGGG + Intergenic
1185337883 22:50278825-50278847 GTGTGCAGACGGGCAGGGGCCGG + Intronic
952883734 3:38000637-38000659 GTGGACAGGCAGGCAGAGACAGG + Intronic
954218136 3:49135696-49135718 CTGGACAGACGCCCTGGGACTGG + Intergenic
954226136 3:49182643-49182665 GTGGGCACACGGCGCGGGACTGG - Intronic
954427006 3:50448738-50448760 GTGGGCAGAAGGGCAGGGACTGG - Intronic
956195806 3:66651909-66651931 GTGGGCACAGGGCCCGGGACTGG + Intergenic
957055404 3:75438856-75438878 GTAGAAAGAAGGCCAGGCACGGG + Intergenic
961279945 3:125758604-125758626 GTGGGCACACGGAGAGGGACTGG - Intergenic
961299409 3:125912803-125912825 GTAGAAAGAGGGCCAGGCACGGG - Intergenic
961710504 3:128824466-128824488 GTGGGGAGAGGCCCAGGGACTGG + Intergenic
964378582 3:156073498-156073520 GTGGGCACACGGCGCGGGACTGG + Intronic
964424044 3:156533487-156533509 GTGGAGAGACAGGCAGGGCCAGG + Intronic
964802826 3:160573967-160573989 GTGGGCACACGGCGTGGGACAGG - Intergenic
965635796 3:170779042-170779064 GAGGACACAGGCCCAGGGACTGG + Intronic
966793799 3:183695943-183695965 GTGGGCTGATGGCCAGGGAATGG - Intergenic
968412744 4:403978-404000 GCGGACACACGGCGTGGGACTGG - Intergenic
968450654 4:674601-674623 GTGGACACACGGCCAGGACGCGG - Intronic
968642061 4:1719934-1719956 GAGGACAGATGGCCAGTGGCTGG - Intronic
969691001 4:8704157-8704179 ATGAACAGAGGGCCAGGGAGGGG - Intergenic
969841573 4:9886826-9886848 GTGGACACAGGGCCAGGGAATGG + Intronic
974076429 4:57172521-57172543 GTGGGGAGACGGACAGGGAGAGG - Intergenic
976322073 4:83727507-83727529 GTGGGCAGACGGCTAGGGAATGG + Intergenic
985695905 5:1339980-1340002 GTGAACAGATGGCCACGCACAGG + Intronic
987156693 5:15096493-15096515 GTGGGCACACGGCGCGGGACTGG - Intergenic
990506657 5:56451904-56451926 GTGAAGACACGGGCAGGGACTGG + Intergenic
992406092 5:76459241-76459263 GTGGGCAGAGGCCGAGGGACGGG + Intronic
994094392 5:95835824-95835846 GGGGACAGAGGGCCAGGCAGTGG + Intergenic
994840808 5:104923118-104923140 GTGAGCAGATGGCCAGGGAAAGG + Intergenic
997210109 5:132072194-132072216 GTGGAGAAAGGGCCAGGGCCTGG + Intergenic
998076054 5:139237301-139237323 GTGGGCAGAGAGCCAGGGAATGG - Intronic
1001282046 5:170393136-170393158 GGTGACAGAGGGGCAGGGACGGG - Intronic
1001843633 5:174901900-174901922 GTGGGCACACGGCGTGGGACTGG + Intergenic
1001913317 5:175539056-175539078 GAGGACAGAGGGCCAGAGAAAGG - Intergenic
1002695390 5:181085087-181085109 GTGGAGAAAGCGCCAGGGACAGG + Intergenic
1003598491 6:7496375-7496397 GTGGACACAAGGCAAGGGCCCGG + Intergenic
1005862465 6:29912063-29912085 GTGGAAAGATGGCCAGAGAGTGG - Intergenic
1005873906 6:29997071-29997093 GTGGAAAGATGGCCAGAGAGTGG - Intergenic
1006014647 6:31070629-31070651 GTGGACAGACTGCAATGGGCTGG + Intergenic
1006640455 6:35486715-35486737 GGGGACAGACAGACAGGAACTGG + Intronic
1007701692 6:43769816-43769838 GCGGAGAGCCGGACAGGGACGGG - Intergenic
1007728222 6:43929664-43929686 GTGGACAGACTGCCAGAGCTGGG + Intergenic
1008467074 6:51842817-51842839 GTGTGCAGAAGGCCAGGGAGGGG + Intronic
1011148817 6:84245584-84245606 GTGGAAAGAGGGACAGGGACAGG + Intergenic
1012491281 6:99785030-99785052 GAGGGAAGAGGGCCAGGGACAGG + Intergenic
1016513190 6:144865909-144865931 GTGGACAGAGGGCTAGGGAATGG - Intergenic
1018921471 6:168178929-168178951 ATGGACAGCAGGCCAGGGAGAGG - Intergenic
1019254746 7:42193-42215 GTGGGCAGAGGACCAGGGAGTGG - Intergenic
1019303861 7:322960-322982 GAGGACAGAGGGCAGGGGACAGG + Intergenic
1020006911 7:4788127-4788149 GTGGACAGACGCCCAAGGCCAGG - Intronic
1020157122 7:5736126-5736148 GTGGGGAGAGGGACAGGGACAGG - Intronic
1020272307 7:6604570-6604592 GTGGACAGAGGGTCAGTGAGTGG + Intronic
1022310225 7:29190035-29190057 GTGCACAGACGGCCCAGGATGGG - Intronic
1023396141 7:39753927-39753949 GCGGGCACACGGCCCGGGACTGG - Intergenic
1023458498 7:40367871-40367893 GAGGACAGATGGCAAGGGCCAGG - Intronic
1023852656 7:44158878-44158900 GTGGGCAGAGGGCCAGTGGCAGG + Intronic
1023880807 7:44320278-44320300 GTGAGCAGCCGGCCAAGGACAGG + Intronic
1025994335 7:66518636-66518658 GTGGGCAGAATGCCAGGGTCAGG - Intergenic
1026147636 7:67761110-67761132 GTGGACAGGGGGCTAGGGAATGG + Intergenic
1026911205 7:74092951-74092973 CAGGACTGAGGGCCAGGGACGGG + Intronic
1029076207 7:97936265-97936287 GTGGGCACACGGAGAGGGACTGG + Intergenic
1032030219 7:128476901-128476923 CGGGACAGACGGCCAGCGACAGG - Intronic
1034634465 7:152556119-152556141 GGGCACAGACAGCCAGGGCCAGG - Intergenic
1034682660 7:152941010-152941032 GTTGCCAGAGGGACAGGGACAGG - Intergenic
1035112163 7:156492246-156492268 GGGGAGAGACAGCCAGGGGCTGG - Intergenic
1037018149 8:13934025-13934047 GTGGATAGGGGGCCAGGGAGTGG - Intergenic
1038822474 8:30965476-30965498 GTGGGCAGAGGGCTAGGGAATGG + Intergenic
1040597905 8:48858205-48858227 CTGCACAGAAGGCCAGGGACTGG + Intergenic
1042610982 8:70600929-70600951 GTGAACACAAGGCCAGGCACAGG + Intronic
1046376115 8:113383232-113383254 GTGGAGAGATGGGCAGGGATGGG + Intronic
1048299461 8:133240591-133240613 GTGTGCAGAAGGCCAGTGACCGG + Intronic
1048465370 8:134661104-134661126 CTGGACAGGCTGCCATGGACAGG + Intronic
1049624988 8:143615901-143615923 GTGGACAGAGGGCCATGCAGGGG - Intronic
1049676301 8:143890787-143890809 GTGGACTGAGAGCCAAGGACGGG - Intergenic
1053393507 9:37752306-37752328 GTGGGCACACGGCGAGGGACTGG + Intronic
1053436154 9:38075706-38075728 GTGGGCACACGGCGTGGGACTGG + Intergenic
1054861456 9:69958089-69958111 GTGAACAGAGGGCTAGGGAATGG - Intergenic
1056080893 9:83093276-83093298 GTGAGCACACGGCGAGGGACTGG - Intergenic
1056765412 9:89441873-89441895 GTGGACAGAGGGCTAGAGGCTGG + Intronic
1057230257 9:93317562-93317584 GTGGACAGAGGGCCGGGCGCTGG - Exonic
1060608553 9:124940518-124940540 GTGACCAGACGCCCAGGGTCTGG - Intronic
1061293691 9:129666129-129666151 GAGTACGGCCGGCCAGGGACGGG + Intronic
1061308932 9:129749816-129749838 GAGCACAGAGGGCAAGGGACAGG + Intronic
1061757685 9:132826806-132826828 CTGGACAGACGGCCAAGGGCGGG - Intronic
1062125331 9:134857504-134857526 GTGGACACACATCCAGGGACAGG + Intergenic
1187112998 X:16320605-16320627 GTGGTCAGAGGGCTAGGGAATGG + Intergenic
1189075341 X:37908472-37908494 GTGGAAAGGCAGCCAGGGAGAGG + Intronic
1189264061 X:39700101-39700123 GAAGACAGAGGGGCAGGGACAGG + Intergenic
1190699852 X:52979553-52979575 GTCGTCAGGCTGCCAGGGACAGG - Intronic
1192227402 X:69238646-69238668 GTGGGCAGAGGGCCAGGGCGGGG - Intergenic
1192554775 X:72080804-72080826 GTGTACAGAAGACCAGTGACAGG - Intergenic
1194714849 X:97276264-97276286 GTGGGGAGAGGGACAGGGACAGG + Intronic
1200161062 X:154009602-154009624 ATATACAGACAGCCAGGGACAGG + Intergenic