ID: 936514728

View in Genome Browser
Species Human (GRCh38)
Location 2:113174363-113174385
Sequence CTGGAGGTCTGCAATAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936514720_936514728 -2 Left 936514720 2:113174342-113174364 CCCTGGCTCCCCGCAGAGCCTCT 0: 1
1: 0
2: 2
3: 24
4: 322
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514715_936514728 22 Left 936514715 2:113174318-113174340 CCACGGACCTCTGTTGTTTCCCT 0: 1
1: 0
2: 0
3: 20
4: 292
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514711_936514728 30 Left 936514711 2:113174310-113174332 CCCTGGCCCCACGGACCTCTGTT 0: 1
1: 0
2: 1
3: 14
4: 202
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514716_936514728 15 Left 936514716 2:113174325-113174347 CCTCTGTTGTTTCCCTTCCCTGG 0: 1
1: 0
2: 6
3: 43
4: 424
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514713_936514728 24 Left 936514713 2:113174316-113174338 CCCCACGGACCTCTGTTGTTTCC 0: 1
1: 0
2: 1
3: 30
4: 629
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514714_936514728 23 Left 936514714 2:113174317-113174339 CCCACGGACCTCTGTTGTTTCCC 0: 1
1: 0
2: 0
3: 5
4: 104
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514721_936514728 -3 Left 936514721 2:113174343-113174365 CCTGGCTCCCCGCAGAGCCTCTG 0: 1
1: 0
2: 4
3: 56
4: 459
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514719_936514728 2 Left 936514719 2:113174338-113174360 CCTTCCCTGGCTCCCCGCAGAGC 0: 1
1: 0
2: 3
3: 77
4: 561
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514724_936514728 -10 Left 936514724 2:113174350-113174372 CCCCGCAGAGCCTCTGGAGGTCT 0: 1
1: 0
2: 0
3: 9
4: 180
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514718_936514728 3 Left 936514718 2:113174337-113174359 CCCTTCCCTGGCTCCCCGCAGAG 0: 1
1: 1
2: 3
3: 28
4: 345
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
936514712_936514728 29 Left 936514712 2:113174311-113174333 CCTGGCCCCACGGACCTCTGTTG 0: 1
1: 0
2: 1
3: 9
4: 143
Right 936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936514728 Original CRISPR CTGGAGGTCTGCAATAGTGA AGG Intronic
904987486 1:34563804-34563826 CTGGAGACCTGGAAGAGTGAGGG - Intergenic
905093751 1:35451055-35451077 CTGGAGGTCTGCATATCTGATGG + Intronic
916789525 1:168113006-168113028 CAGGAGGTCTGGAGTAGCGAAGG + Intronic
919755937 1:201066317-201066339 CTGGGGGGCGGCAATGGTGAGGG + Intronic
920405539 1:205706599-205706621 CTGAAGGTGTTCAATGGTGAAGG - Intergenic
920455437 1:206097718-206097740 CTGGAGATCTGCAAGAGGTAAGG - Exonic
1072432016 10:95380902-95380924 CTGGAGGACTGCAATGTTTATGG + Intronic
1076126800 10:127980932-127980954 CTGCACGTCTGCACTGGTGAAGG - Intronic
1076128912 10:127998154-127998176 CTGGCTGTCTGCAGTAGAGATGG + Intronic
1076278522 10:129225534-129225556 CTGGAGGAATCCAGTAGTGAGGG + Intergenic
1077313791 11:1906617-1906639 AGGGAGGTCTGGAATAGTGTGGG + Intergenic
1079648892 11:22901600-22901622 CTGCAGGTTTGCATTAGAGAAGG + Intergenic
1080838357 11:35961314-35961336 CTGGAGGTGTGGGAGAGTGATGG + Intronic
1081496050 11:43611559-43611581 CTGGAAGTCTGCAGTTATGAAGG - Intronic
1086810186 11:91300396-91300418 CTGGAGGTCTGCTGTTCTGAAGG + Intergenic
1092423725 12:8356257-8356279 GTGGAGACCTGCTATAGTGAGGG - Intergenic
1095245303 12:39912717-39912739 CTGGAGCCCTGCCATAGTGTGGG + Intronic
1096002740 12:48142924-48142946 CTGCAGGTCTCGAATGGTGAAGG - Exonic
1097350845 12:58547051-58547073 CTGGAGGGCTGGGATAGAGAGGG + Intronic
1100163158 12:91884856-91884878 CTGGAGGTCTGTAAAAGAGATGG + Intergenic
1100679376 12:96901966-96901988 CAGGATGTCTGCAAAACTGATGG - Intergenic
1105274592 13:18907535-18907557 CTGGAGCTATGCAAGAGTCAGGG + Intergenic
1105298867 13:19115635-19115657 CTGGAGCTATGCAAGAGTCACGG - Intergenic
1107687910 13:42922559-42922581 CTGGAGGTCAGCAATAAAAATGG - Intronic
1111357614 13:87129222-87129244 CTGGTGGTCTGAATGAGTGAAGG - Intergenic
1111813617 13:93122511-93122533 CTTGAGGTCTGCGACAGTGGAGG - Intergenic
1115914980 14:38301967-38301989 CTGGAGCTCTCCAATGGTCAGGG - Intergenic
1116970697 14:51061895-51061917 CTGGAGTCCTGCAATAGTAGGGG - Intronic
1128162437 15:65432556-65432578 CTGGAGGTAAATAATAGTGATGG + Intergenic
1131103055 15:89709013-89709035 CCGGACGGCTGCAATAGTGTGGG - Intronic
1132177817 15:99729153-99729175 CTGGCTGTCTGCAGAAGTGACGG + Exonic
1132856776 16:2048515-2048537 CTGGAGGTCCGCAGTGGGGAAGG + Intronic
1133139547 16:3734252-3734274 CTGGGGGTCAGCCTTAGTGAGGG - Intronic
1136477373 16:30521866-30521888 CAAGAGGGCTGCAAAAGTGAGGG + Exonic
1138077311 16:54055449-54055471 CTAGAGGTCTGCAAAGGTGCAGG + Intronic
1138449422 16:57084575-57084597 CTGGAGGGCTGCAAAGGTCAAGG - Intergenic
1138765128 16:59592802-59592824 CTGCAGGTCTTGAATAATGATGG - Intergenic
1140151322 16:72369904-72369926 AGTGAGGTCTGCTATAGTGATGG - Intergenic
1142240990 16:88944987-88945009 CTGAAGGTCAGCAACAGTGATGG - Intronic
1142469965 17:157803-157825 CTGGAGGCTTGTACTAGTGAAGG + Intronic
1142478621 17:204573-204595 ATGGAGGTCTGGATGAGTGAGGG - Intergenic
1143109611 17:4545754-4545776 CTGGGGGTCTGCAAGAGGGAGGG + Exonic
1145894627 17:28447222-28447244 CTGGGGGTCTGCAATAAGGGCGG + Intergenic
1150454472 17:65295628-65295650 CAGGAGCTCTGCTATAGTAAAGG + Intergenic
1150644604 17:66970051-66970073 ATGAAGGTCTTCCATAGTGATGG - Intronic
1152413230 17:80141797-80141819 CTGGAGGACTGAGATACTGAAGG + Exonic
1152640357 17:81446888-81446910 CTGCAGGTCTGCAAGACTGGTGG - Intronic
1154466279 18:14644788-14644810 CTGGAGCTATGCAAGAGTCAGGG + Intergenic
1157851593 18:51058142-51058164 CTGGGGGGCAGCCATAGTGAAGG + Exonic
1160376858 18:78420290-78420312 CTGCAGGTCTGCCAGAGGGATGG - Intergenic
1161703534 19:5807167-5807189 CTGGAGGCATGGAATAGTCAAGG + Intergenic
1161935035 19:7366292-7366314 CTGGAAGTTTCCAATAGTGGTGG - Intronic
1165360636 19:35334690-35334712 GTGGATGGCTGCAATACTGAAGG + Intronic
1166395987 19:42441517-42441539 CTGGGTGTCTGTCATAGTGATGG + Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
927568390 2:24135953-24135975 CTGAAGGTCAGTTATAGTGAAGG + Intronic
927848523 2:26484626-26484648 CTGGTGCTCTGCAATGATGAGGG + Exonic
931488500 2:62718579-62718601 CTGTAGGTCTGTGATAGTGATGG + Intronic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
933252870 2:80048598-80048620 CTGGAGAACTGAAATTGTGAAGG + Intronic
936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG + Intronic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
938959905 2:136331603-136331625 CTGGAGGGCTACACTAGTGTGGG - Intergenic
941259209 2:163274788-163274810 CAGGGGGTCTGCAACAGTGATGG + Intergenic
943027098 2:182643059-182643081 CTGGAGGGCTGCACTAGACAGGG - Intergenic
945296917 2:208179571-208179593 CTGGAGGTATCCAAAGGTGAAGG + Intronic
948179451 2:235968158-235968180 CTGGAGCTCTGCAAAAGGAAAGG - Intronic
1170494925 20:16915204-16915226 CTGCATGTCTGCAATGGTGTGGG - Intergenic
1170611994 20:17922272-17922294 CAGGTGGTCTGAAATTGTGAAGG + Intergenic
1173100850 20:40086886-40086908 CTGGAGGACTGGAATAGAGGGGG + Intergenic
1174653802 20:52152749-52152771 CTGGAGGTGTCCCACAGTGAGGG + Exonic
1177129343 21:17237420-17237442 CTGGAGGTTAGTAACAGTGATGG + Intergenic
1177438555 21:21087805-21087827 CTGGAAGGCTGAAATAATGAAGG + Intronic
1178484810 21:33012293-33012315 CTGGAGGGCTGAAATATGGATGG - Intergenic
1179273399 21:39868926-39868948 CTGGGGCTCTGAAATAGAGATGG + Intronic
1182324983 22:29505659-29505681 CTGGAGGTCTGCATTATCCATGG + Intergenic
1182803956 22:33054978-33055000 CTAGAGGACAGCAATAGTGTTGG - Intronic
1184045479 22:41970079-41970101 CTTGAGGTCTGCAGCAGGGACGG - Intergenic
1184401708 22:44278415-44278437 CTGGAGGACTGTATTAGTCAGGG - Intronic
1184542075 22:45132755-45132777 CAGGAGGTCTGCCAAAATGAGGG - Intergenic
1185050490 22:48551685-48551707 CTCGTGGTCTGCAGCAGTGATGG + Intronic
953216621 3:40924338-40924360 CTAGAGGTCAGCAACAGTTAAGG - Intergenic
960695948 3:120396489-120396511 CTGGAGGTCTGTCATGCTGACGG + Exonic
960920673 3:122744586-122744608 CTGGAGGTCTGGTTTGGTGAAGG + Intronic
966139957 3:176745690-176745712 CTGGAGGTGAGCATTAGTGTGGG - Intergenic
966226129 3:177599888-177599910 CAGGAGGTGTGGAATCGTGAAGG - Intergenic
968129904 3:196186985-196187007 CTGGAGGTCTTCATCAGGGAAGG - Intergenic
968690221 4:1986403-1986425 CTGGAGGACGGCAACAGTCAGGG + Intronic
969926558 4:10591156-10591178 GTGGAGGTTTGCAAGAGTAAAGG + Intronic
970865798 4:20757335-20757357 CTTGAGGTCAGCAATACTGCAGG - Intronic
973057560 4:45679613-45679635 CTGGAAGTTTGCCATAGTTATGG - Intergenic
973584343 4:52375774-52375796 CTGGTGGTATGGACTAGTGATGG - Intergenic
976092027 4:81469077-81469099 CTATAGGTCTGAAAAAGTGAGGG + Intronic
977570115 4:98620462-98620484 CTGCAGGTCAGGAATAGAGACGG - Intronic
981284902 4:143005418-143005440 ATTGAGGTCCTCAATAGTGAAGG - Intergenic
983712138 4:170731393-170731415 CTGGAGGACTGCAATAAGCAAGG - Intergenic
985749339 5:1665475-1665497 CTGGAGGGCTGCCATGGTGATGG - Intergenic
990123403 5:52484177-52484199 CAGGAGGGCTGTAATAGGGATGG - Intergenic
990404320 5:55472912-55472934 CTGGAGGGCTGCAGTAGAGCAGG - Intronic
995802696 5:116016615-116016637 CTGTGAGTCTGCAAAAGTGAGGG - Intronic
996194152 5:120582951-120582973 CTGGAAGTCTCAAATATTGAAGG + Intronic
999482298 5:151959851-151959873 CTGAAGGGCTGCCATAGGGAAGG + Intergenic
1000230046 5:159307386-159307408 CTTGAGGTCTGATATAGGGATGG - Intergenic
1000973243 5:167737592-167737614 CTGGAGGTCTACAATCATGCTGG + Intronic
1001739472 5:174039813-174039835 CTGGTGGACTGCACTATTGATGG - Intergenic
1002679922 5:180953368-180953390 AGGGAGGTCTTCAATAGTGATGG + Intergenic
1005490517 6:26343347-26343369 CAGCAGGTCTCCAATAGGGAAGG + Intergenic
1018831810 6:167448997-167449019 CTTGAGGTCTGCCCTAGAGACGG - Intergenic
1019105733 6:169665223-169665245 CTGGAGTGCAGCAAAAGTGAGGG - Intronic
1024100101 7:46023297-46023319 CTATAGGTCTGGATTAGTGAAGG - Intergenic
1026427166 7:70307308-70307330 CTTCAGGTGTTCAATAGTGATGG - Intronic
1026491275 7:70866114-70866136 CTGTAGGACTGCAGAAGTGATGG + Intergenic
1029306929 7:99626427-99626449 CTGGAGGGTTGAAATAGTGTAGG + Intronic
1030536825 7:110777695-110777717 CTGAGGATCTGCAATAGTGGTGG + Intronic
1035854778 8:2963168-2963190 CTGCAGGTCTGCAACAGGGACGG - Intronic
1043585314 8:81761788-81761810 TTGGAGTTCTGAAATGGTGACGG + Intergenic
1045223119 8:100217527-100217549 CTGGAGGTCTAAAAGAGTCATGG - Intronic
1045397975 8:101780630-101780652 CTGGAGATGTACAATAGTAATGG + Intronic
1051733952 9:20179028-20179050 CTGGAGGTCTGCCATATGCAAGG - Intergenic
1055123245 9:72687436-72687458 CTGAAAGTTTGCAATAATGAAGG - Intronic
1055923778 9:81489146-81489168 CTGAAGGTTGGCAATAGTGGAGG - Intergenic
1056000360 9:82210093-82210115 GTGGATGTCTGCAGTGGTGATGG + Intergenic
1059349695 9:113655855-113655877 GTTCAGGTCTGCAATAGGGAAGG + Intergenic
1059536156 9:115082890-115082912 CTGGATGTCTGCAACAGTCAGGG + Intronic
1187265247 X:17726214-17726236 CAGCAGGTCTGCAACAGTGGAGG - Exonic
1192946203 X:75967456-75967478 TAGGAGGTTTTCAATAGTGATGG + Intergenic
1194114598 X:89880485-89880507 ATGGGGGTCTGCAGTGGTGATGG - Intergenic
1195068337 X:101257046-101257068 TTGGAGGTCTGGAATAGGGATGG + Intronic
1199056987 X:143308085-143308107 CTGGAGGTATGGGATAGAGAAGG + Intergenic
1200467339 Y:3535883-3535905 ATGGGGGTCTGCAGTGGTGATGG - Intergenic