ID: 936515921

View in Genome Browser
Species Human (GRCh38)
Location 2:113181597-113181619
Sequence GAGATCTCTGCCTTCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936515921_936515929 4 Left 936515921 2:113181597-113181619 CCTCCCTAGAAGGCAGAGATCTC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 936515929 2:113181624-113181646 CCATGCAGCAGGCAGTCTGCTGG 0: 1
1: 0
2: 3
3: 35
4: 310
936515921_936515924 -7 Left 936515921 2:113181597-113181619 CCTCCCTAGAAGGCAGAGATCTC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 936515924 2:113181613-113181635 AGATCTCCTCCCCATGCAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 151
936515921_936515931 8 Left 936515921 2:113181597-113181619 CCTCCCTAGAAGGCAGAGATCTC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 936515931 2:113181628-113181650 GCAGCAGGCAGTCTGCTGGGTGG 0: 1
1: 2
2: 2
3: 50
4: 413
936515921_936515934 20 Left 936515921 2:113181597-113181619 CCTCCCTAGAAGGCAGAGATCTC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 936515934 2:113181640-113181662 CTGCTGGGTGGTAGGCAGCAGGG 0: 1
1: 1
2: 5
3: 52
4: 372
936515921_936515932 12 Left 936515921 2:113181597-113181619 CCTCCCTAGAAGGCAGAGATCTC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 936515932 2:113181632-113181654 CAGGCAGTCTGCTGGGTGGTAGG 0: 1
1: 0
2: 5
3: 93
4: 684
936515921_936515930 5 Left 936515921 2:113181597-113181619 CCTCCCTAGAAGGCAGAGATCTC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 936515930 2:113181625-113181647 CATGCAGCAGGCAGTCTGCTGGG 0: 1
1: 0
2: 2
3: 57
4: 376
936515921_936515933 19 Left 936515921 2:113181597-113181619 CCTCCCTAGAAGGCAGAGATCTC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 936515933 2:113181639-113181661 TCTGCTGGGTGGTAGGCAGCAGG 0: 1
1: 0
2: 6
3: 17
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936515921 Original CRISPR GAGATCTCTGCCTTCTAGGG AGG (reversed) Intronic
900313820 1:2047523-2047545 GAGACCTCTGCCTCCTGGAGGGG + Intergenic
901019963 1:6250498-6250520 GAGATCTCCGCCCTGGAGGGGGG - Exonic
903452828 1:23466207-23466229 GAGCTCACTGCCTTCAGGGGTGG - Intronic
903808444 1:26021559-26021581 TAAATCTCTGCCTTGGAGGGTGG + Intronic
904393570 1:30202335-30202357 GAGAGCTCTGCCTTCATGGTTGG - Intergenic
906899599 1:49819738-49819760 GAGATCTCTTACCTCAAGGGAGG + Intronic
906951102 1:50334987-50335009 GAGTTCTCTGCCTCCTGAGGTGG - Intergenic
911941894 1:104057517-104057539 CAGATCTCTTCTCTCTAGGGAGG + Intergenic
912567166 1:110596126-110596148 GAAAGATCTGCCTTCTAGAGAGG + Intronic
914862575 1:151398941-151398963 GAGAACTGTGACTTCTAGGCCGG + Intergenic
918365681 1:183805332-183805354 GAGCTCTCTGCCTTCTCCCGAGG + Intronic
920646014 1:207804975-207804997 GAGAGCTCTGCCATCCAAGGAGG + Intergenic
921373246 1:214447288-214447310 GGAATCTCAGCCTTCTTGGGAGG - Intronic
922662270 1:227440368-227440390 GAGATCTCAGTGTTCCAGGGCGG - Intergenic
1063113713 10:3058021-3058043 GACAGCTCTGCATTCTTGGGAGG - Intergenic
1064402564 10:15033819-15033841 GAGGGCTCTGCCTTCATGGGTGG - Intronic
1067178015 10:43963833-43963855 ATGTTCTCTGCCTTCTAGGATGG - Intergenic
1069241702 10:66148470-66148492 GAGGTCTCTGCCCTCGAGGATGG + Intronic
1071869715 10:89780869-89780891 GAGCCCACTGCCTTCAAGGGTGG - Intergenic
1073996736 10:109324340-109324362 GAGAACTCTGCCTTCTTGTCTGG + Intergenic
1074696579 10:116055315-116055337 GAGATGTCTGCCATCCAGGCTGG - Intergenic
1076344661 10:129772258-129772280 GAAAGCTCTGCCCTCTAGGCTGG + Intergenic
1078165895 11:8884756-8884778 GAGAGTTCTGCCTTAAAGGGTGG - Intronic
1078652877 11:13212367-13212389 GAGTTCTCTGTCTTAGAGGGTGG - Intergenic
1079426875 11:20351996-20352018 TAGACCTCTCCCTTCTAGGGAGG - Intergenic
1079452652 11:20610516-20610538 GTGATCTCTCCCGTCTTGGGTGG + Intronic
1083624738 11:64066685-64066707 GAGATGTCTGCCTGCAAGGTGGG + Intronic
1083782931 11:64927276-64927298 CACATCCCTGCCTTCTAGGCAGG - Intronic
1084038328 11:66526905-66526927 GAGATCTCGGCCAACTAGGTAGG + Intronic
1086164607 11:83763033-83763055 GGGAACTTTGCCTTCAAGGGTGG - Intronic
1086572766 11:88304443-88304465 CAAATCTCTGCCTTATAGGATGG - Intronic
1088736987 11:112735980-112736002 CAGAACTCTGCCTTTTAGGAAGG + Intergenic
1088743824 11:112787918-112787940 AAGCTCTCTGCCTTCTTGAGTGG + Intergenic
1091060551 11:132457508-132457530 GGGATTCCTGCCTTCTATGGAGG + Intronic
1091147002 11:133288781-133288803 GAGACCTCTGCTTTCTATGTTGG + Intronic
1091239574 11:134043521-134043543 GTGCTCTCTGCATTCTGGGGGGG - Intergenic
1098144561 12:67485471-67485493 GAAATGTCTGCATTCTAGGAAGG + Intergenic
1098458477 12:70703843-70703865 GAGATCTCTTCCATCTGGAGTGG + Intronic
1103010367 12:117453938-117453960 GAGACCTCTGCCTTGTAGACGGG + Exonic
1107691180 13:42955249-42955271 GAGTTCCCTGCCCTCCAGGGTGG + Intronic
1108512043 13:51165122-51165144 GAGATTTCTGCCTTCTATTCGGG + Intergenic
1110145139 13:72181261-72181283 GAGGTCTCTGCCTACATGGGTGG + Intergenic
1113202139 13:107877378-107877400 GAGGTCTCTGCCATCCAGGCAGG - Intergenic
1120169046 14:81230946-81230968 GAGACCTATGCCATTTAGGGTGG - Intergenic
1121305373 14:92903328-92903350 GAGATCTCTGCTTCCAAGGCTGG - Intergenic
1122044328 14:99012469-99012491 GAGCTCACTGCCTCCCAGGGTGG - Intergenic
1122264186 14:100539071-100539093 TAGATGTCTCCCTTGTAGGGGGG + Exonic
1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG + Intronic
1125138499 15:36373663-36373685 CAGATCTCTTCCTCTTAGGGTGG - Intergenic
1127939923 15:63684686-63684708 AAGTTCTCTACCTTCTAGCGGGG + Intronic
1129235656 15:74222340-74222362 GAGTTCCCGGCCTTCTAGCGAGG - Intergenic
1129700098 15:77762874-77762896 GAGCTCCCTGCCCTGTAGGGAGG - Intronic
1132291409 15:100706198-100706220 GAGATCCCCGCCTTCTCTGGAGG + Intergenic
1134591107 16:15454056-15454078 CACATCTCTGCTCTCTAGGGGGG + Intronic
1139601675 16:67991173-67991195 GAGCTCTCTGCCCTGCAGGGTGG + Exonic
1139709494 16:68764864-68764886 AAGATCTCTGGCTCCTAGTGCGG + Intronic
1141422386 16:83925510-83925532 GACAACTCTGCCTGCTGGGGTGG - Exonic
1142222445 16:88862161-88862183 GAAATCTTTGCCTTTTAGTGGGG + Exonic
1146321733 17:31852111-31852133 GAGCTTTCTGCCTTGTAGGTGGG - Exonic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1148675068 17:49440234-49440256 GAGATCTCCACCTTCCGGGGTGG + Intronic
1151328666 17:73394101-73394123 TAGGTCTCTGCCTCCTAGAGTGG - Intronic
1152380457 17:79939739-79939761 GGGCTCTCTGCCTTCTATGTGGG - Exonic
1153453540 18:5256277-5256299 GAGAGCTCTGCCTTCATGAGTGG - Intergenic
1155038502 18:22045319-22045341 GTGATCTCTGGCTTCTGGGCTGG + Intergenic
1155914785 18:31546113-31546135 AAGATCTGTGTCTTCTAGGCAGG + Exonic
1156069869 18:33194016-33194038 GAGTGCTCTGCCTTCATGGGTGG - Intronic
1157135289 18:45048274-45048296 GTGATTTCTGCCTTCTAGGCAGG + Intronic
1157915544 18:51660450-51660472 GTTTGCTCTGCCTTCTAGGGGGG + Intergenic
1160812720 19:1019968-1019990 GAGACCTCTGCCATCTGAGGAGG + Intronic
1162539339 19:11284745-11284767 GAGGCCTCTGCATTCTTGGGTGG - Intergenic
1163936535 19:20449961-20449983 GAGATATCTGCTCTCTAGGGTGG + Intergenic
1165074846 19:33275078-33275100 GAGCTCTCTGCCATGTTGGGAGG + Intergenic
1165235820 19:34420832-34420854 GGGACCTCTGCCTTAGAGGGAGG - Intronic
1165312653 19:35038194-35038216 GGGATCTCAGCCATCTAGGAGGG + Intronic
1166069972 19:40381288-40381310 GAGCTCTCTGGCTGCTAGGAGGG + Intronic
1166742997 19:45125579-45125601 GAGCTCTCTTCCCACTAGGGTGG - Intronic
1167741419 19:51326793-51326815 GAGATCTCTGACATCCAGCGGGG + Exonic
1167882426 19:52471110-52471132 CATCTCTCTGACTTCTAGGGAGG - Intronic
926029617 2:9574874-9574896 CAGATCTTTGACTTCTAGGCTGG + Intergenic
926234822 2:11032517-11032539 GATATGTTTGCCTTCTAGGTGGG - Intergenic
927957531 2:27217921-27217943 AAGATCTGTGCCTTGTAGGAGGG - Exonic
928767584 2:34665794-34665816 TAAATCTCTACCTTATAGGGAGG + Intergenic
931997839 2:67856174-67856196 GACAGCTCAGCCTTGTAGGGTGG - Intergenic
932344627 2:70987576-70987598 GATATATCTGCCTTCTAAGAAGG - Exonic
932750104 2:74366106-74366128 GAAAACCCTGCCTTCTAGGCAGG + Intronic
932839639 2:75069984-75070006 CAGATATCTGTCTTCAAGGGAGG - Intronic
936515921 2:113181597-113181619 GAGATCTCTGCCTTCTAGGGAGG - Intronic
938722166 2:134076599-134076621 GGCATCTCTGCATTCTTGGGGGG - Intergenic
938935828 2:136126701-136126723 GAGAACTGGGCTTTCTAGGGTGG - Intergenic
939442712 2:142270637-142270659 GAGATCTGTGCCTTCTCGGTGGG + Intergenic
941336753 2:164255068-164255090 GAGACCTCAGGCTTCTGGGGAGG + Intergenic
942973400 2:181984821-181984843 GAGATCTCTGCTTTCTTGAGAGG - Intronic
945188720 2:207165652-207165674 TGGATGTCTGCCTTCTTGGGGGG - Exonic
945285394 2:208077001-208077023 GAGAGCTTAGCCATCTAGGGAGG - Intergenic
1169764130 20:9130159-9130181 GGGGTGTCTGGCTTCTAGGGAGG + Intronic
1172641064 20:36440776-36440798 TAGGTGTCTGCCTTCTCGGGGGG - Intronic
1174307879 20:49627424-49627446 GAGGTCTCTGCTGTGTAGGGAGG - Intergenic
1181378044 22:22476195-22476217 GCAATCTCTGCCTCCTGGGGGGG + Intergenic
1181673257 22:24435927-24435949 AAGCTCTCTGCCCTCAAGGGAGG - Intronic
1181928214 22:26377428-26377450 GTGATCTCTCCTTACTAGGGAGG - Intronic
1181931651 22:26406436-26406458 GAGAGCTGTGGATTCTAGGGAGG + Intergenic
1181939315 22:26463266-26463288 GACATCCCAGCCTTCTAGGAAGG + Intronic
1182431335 22:30300657-30300679 GAGATTTCTCCCCTCTAGGCTGG - Intronic
1182842223 22:33400592-33400614 GCCATCTCTCCCTTCTGGGGAGG - Intronic
1184562404 22:45270711-45270733 GAGAACTCTTCATTCTGGGGTGG + Intergenic
955766764 3:62352734-62352756 GGCATATCTGCCTTCTATGGAGG + Intergenic
956002560 3:64745009-64745031 AGGATCTCTGCCTGCTAGGAGGG + Intergenic
956297422 3:67729453-67729475 GAGATCTTTGCCTTCTTGATGGG + Intergenic
959041119 3:101424210-101424232 GAGCTCTCTGCCTGTTAGGCAGG - Intronic
960845274 3:121998988-121999010 ATGACTTCTGCCTTCTAGGGTGG + Intronic
962312103 3:134334063-134334085 GTTATCTCTGCCTTCTGGGCCGG - Intergenic
962755098 3:138460497-138460519 GAGAACCCAGCCTTCCAGGGTGG - Intronic
963783366 3:149509312-149509334 GTGATCTCTGCCTTCTGTGATGG + Intergenic
964023771 3:152046403-152046425 TCCATCTCTGCCCTCTAGGGTGG - Intergenic
964863719 3:161230698-161230720 AAGATCTCTGCTCTCTAGAGGGG + Intronic
966890786 3:184406134-184406156 CAGATCTTTGCCTTCCAGGAGGG + Intronic
980152200 4:129061379-129061401 GAGATGTCTGGCCTGTAGGGTGG + Intronic
983440166 4:167772007-167772029 GCTATCTCTGCCTTCTAGGTCGG + Intergenic
986840403 5:11690475-11690497 GAAATCTATGCTTTCTTGGGAGG + Intronic
988179556 5:27772277-27772299 GAGATCACTGCATTCTAGCCTGG + Intergenic
989482211 5:41944971-41944993 GAGATCTAAGCTTTCTAGGAAGG + Intergenic
993457065 5:88139775-88139797 GAGATCGCTGCATTCTAGCCGGG - Intergenic
994819097 5:104625337-104625359 GAAAGCTCTGCCTTCTTAGGAGG - Intergenic
995287644 5:110409877-110409899 GAACTCTTTGCCTTATAGGGAGG - Intronic
998151560 5:139760327-139760349 GAGCTCTCTGTCTTCCAGGGTGG + Intergenic
998592253 5:143490069-143490091 GAGATCTCTGCTTGCTCTGGTGG - Intergenic
1000672814 5:164083487-164083509 AAGAACTCTGCCTTCTGGGCCGG - Intergenic
1001049257 5:168401309-168401331 CAGATTTCTCCCTTCTAAGGGGG + Intronic
1001269847 5:170302881-170302903 GAGTTCTGTGCCTTCTAGTGTGG - Intergenic
1001958387 5:175864155-175864177 GTGATCTCTACCTTCCAGGGTGG - Intronic
1002902060 6:1417490-1417512 GGCGTCTCTGCCTTCTTGGGGGG + Intergenic
1004040632 6:11971567-11971589 GAGATCTCTGCACTCTAGCCTGG - Intergenic
1005587459 6:27290877-27290899 GAGATCCCTGCCTTTAAAGGGGG + Intronic
1010034428 6:71307302-71307324 GTGAGCTCTGACTTCTGGGGAGG + Exonic
1010280568 6:74018582-74018604 GGCATCTGTGCCTTCTGGGGTGG + Intergenic
1015888883 6:137949099-137949121 GAGATCTCTGCACTCTAGCCTGG + Intergenic
1018486696 6:164247439-164247461 TGGATCTCTGCCTCCTACGGAGG + Intergenic
1019893891 7:3967942-3967964 AAGATCCCTGCCTTCTAGAAAGG + Intronic
1023743447 7:43301367-43301389 CATCTCTCTCCCTTCTAGGGGGG + Intronic
1024506845 7:50168909-50168931 GAGAGCTCTGGATTCTAGGCTGG - Intergenic
1031665447 7:124477734-124477756 AAAATCTCTGCCATCCAGGGAGG - Intergenic
1032350533 7:131158906-131158928 TAGATCCCTGCCTTCTAGTAGGG + Intronic
1034786775 7:153933766-153933788 GAGAAATCTGCCTGCTGGGGGGG - Intronic
1034818416 7:154195050-154195072 GAAATCTCTGCCTAGTAGAGAGG + Intronic
1037063043 8:14539850-14539872 GACATCTCTGCATTCCAGGCTGG - Intronic
1040415928 8:47196004-47196026 GATGTCCCTGCCTTCTTGGGTGG - Intergenic
1046728737 8:117702512-117702534 GTGCTGTCTGCCTTCTAGGAAGG - Intergenic
1048503699 8:135001759-135001781 GAGATTTCTGCCTTCTAGGTTGG - Intergenic
1053463264 9:38287155-38287177 ATGATCTCTGTCTTCCAGGGTGG + Intergenic
1058562961 9:106249215-106249237 GAGAGCTCTGCCTTCATGAGTGG + Intergenic
1058563109 9:106250535-106250557 GAGAGCTCTGCCTTCATGAGTGG - Intergenic
1060188502 9:121577969-121577991 GAGATCTCTCCCTCCTGGGAAGG + Intronic
1060502130 9:124167011-124167033 GACATCCTTGCCTTGTAGGGGGG + Intergenic
1186509377 X:10118930-10118952 AAGATCACTGCATTCAAGGGTGG - Intronic
1189802787 X:44707348-44707370 TAGCACTCTGCCTTCTATGGGGG - Intergenic
1190583680 X:51915389-51915411 GAGATCTCTGCCTTCATGAATGG + Intergenic