ID: 936518328

View in Genome Browser
Species Human (GRCh38)
Location 2:113196522-113196544
Sequence TCTGGGGCCCAGGAATAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936518328_936518330 -8 Left 936518328 2:113196522-113196544 CCTAGTTATTCCTGGGCCCCAGA 0: 1
1: 0
2: 1
3: 14
4: 198
Right 936518330 2:113196537-113196559 GCCCCAGAGTCCCTGTAGTAAGG 0: 1
1: 0
2: 1
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936518328 Original CRISPR TCTGGGGCCCAGGAATAACT AGG (reversed) Intronic
900078751 1:839005-839027 TCAGGGGCCCAGCAGTAAATTGG + Intergenic
900464054 1:2815527-2815549 TCAGGAGCTCAGGAAGAACTGGG + Intergenic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
901507165 1:9692164-9692186 TCTGGGGGCCTGGAATAGCTGGG + Intronic
901735756 1:11311134-11311156 TCAGGGGACCAGGCATACCTGGG + Intergenic
903019474 1:20383964-20383986 TCTGGGGCCCAGGAAGGATTTGG - Intergenic
904683195 1:32242796-32242818 GCTGGGGCCCAGGGATGACTGGG + Intergenic
905732874 1:40308218-40308240 CCTGGGGTCCACGAATACCTGGG + Exonic
906804695 1:48769339-48769361 ACTGGGGCACAGAAAAAACTGGG + Intronic
909253159 1:73383701-73383723 TCTGAGACCCTGGAATAATTAGG + Intergenic
909837621 1:80276693-80276715 TCTGGTGCCCAGGAATAATCAGG - Intergenic
910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG + Intergenic
911944654 1:104091845-104091867 TCTGGGTCCCGGGAATAAAGGGG + Intergenic
913097693 1:115534936-115534958 TCTGGTGTCCAGGAAAAACCAGG - Intergenic
913102984 1:115586777-115586799 TCTGGGGTTCAGGAATAATCAGG - Intergenic
914390064 1:147213172-147213194 TCTGGGGAACAAGAATAATTAGG + Intronic
915490405 1:156247321-156247343 TCTGGGGCTGAGGGATACCTGGG - Intronic
915571035 1:156745128-156745150 TTTGGGGCCCAGGAATGCCCTGG + Exonic
915741616 1:158123044-158123066 TCTGGTGCCCAGGGGTAAGTGGG - Intergenic
916204334 1:162300727-162300749 TCTGGGGCTCAGTGATATCTTGG - Intronic
916248859 1:162716316-162716338 GCTGAGGCCCAGGACTGACTTGG - Intronic
917218042 1:172698269-172698291 TTTGGGGACCAGGAACCACTGGG + Intergenic
917727481 1:177841272-177841294 TCAGGGGCCTGAGAATAACTGGG + Intergenic
917881614 1:179342653-179342675 TCTCAGTCACAGGAATAACTTGG + Intronic
918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG + Intergenic
920382162 1:205541466-205541488 TCTGCAGCCCAGGAACACCTAGG - Intergenic
920840197 1:209547510-209547532 TCTGGGGCCTAGGTATTTCTTGG - Intergenic
920848955 1:209615631-209615653 TCAGGGGCCCAGGGATAATTAGG - Intronic
922875827 1:228939223-228939245 TGTGAGGCGAAGGAATAACTAGG - Intergenic
922956682 1:229608148-229608170 TATGGGGGCCAGGTAAAACTAGG - Intronic
923834092 1:237590813-237590835 TTTTGGGCCCAAGAATGACTTGG + Exonic
923881987 1:238113649-238113671 TCTGGTGCCAAGTAATAATTTGG + Intergenic
1062823709 10:553167-553189 ACTGGGGCCCAGGAAGAGCTGGG + Intronic
1062939636 10:1411470-1411492 TCTTGGGTCCAGCAGTAACTTGG - Intronic
1063071444 10:2670748-2670770 TCTGGAGTCCAGGAATATATAGG - Intergenic
1065725830 10:28667273-28667295 CCTGGGGCCCAGCATTAGCTTGG - Intergenic
1069099296 10:64298219-64298241 TCTGAGGCCCAGAAAGCACTTGG + Intergenic
1071943536 10:90614923-90614945 ATTGGGGCCCAGGCATAAGTAGG - Intergenic
1073152825 10:101323323-101323345 TCAGGGGCCCTGCAGTAACTGGG - Intergenic
1073685353 10:105746545-105746567 TCTGGGGCTCCAGAATATCTAGG - Intergenic
1074201215 10:111237189-111237211 TTTGGGGCCCAGGGATCATTGGG + Intergenic
1077101984 11:826400-826422 TCTGGGGCCCAGCCCTGACTGGG - Intronic
1077712998 11:4554455-4554477 TCTGGGGTCCAGGAAAAATCAGG - Intergenic
1078452823 11:11453059-11453081 TCTGGGTCCCAGGGAGAAATAGG + Intronic
1079394573 11:20050729-20050751 TCTGCGGCCCAGGCATAGCTAGG - Intronic
1081455476 11:43218071-43218093 TCTGGTGCTGGGGAATAACTTGG + Intergenic
1081575744 11:44317688-44317710 TCTGGGGGCCAGGAACTCCTTGG - Intergenic
1084939362 11:72604127-72604149 TGTGGGGCCCAGGGAGCACTGGG - Intronic
1086074989 11:82841138-82841160 TCTGGGCAGCAGGAATAACAGGG + Intronic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1087062104 11:93989270-93989292 ACTGGAGCCCAGGAAGAGCTGGG + Intergenic
1087887244 11:103495123-103495145 TCTGGCGTCCAGGAAGAATTAGG - Intergenic
1087914161 11:103789201-103789223 TCTGGAGCCCAGGACTGCCTGGG + Intergenic
1088448281 11:109955242-109955264 TCTGGTGTCCAGGAAGAATTGGG - Intergenic
1090678930 11:129032087-129032109 TCTGGGGTCCAGGAAGAATCAGG - Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1094352497 12:29542602-29542624 GGTGGGGCCCAGGAATCATTAGG + Intronic
1096649013 12:53052903-53052925 TCCTGGGCCCTGGAAAAACTGGG + Intronic
1096829727 12:54304659-54304681 TCTGGGACCAAGGAATAGCGAGG + Intronic
1096839989 12:54374287-54374309 TCTGAGCCCCAGGAATAACCAGG - Intronic
1097746590 12:63310400-63310422 TCTAGTGCCCAGGAAGAATTAGG + Intergenic
1098384378 12:69903477-69903499 TCCTGGGCCCCGGAATTACTTGG + Intronic
1104468209 12:129007071-129007093 CCTGGACCCCAGTAATAACTTGG - Intergenic
1105341756 13:19532761-19532783 TCTTGGGCCTAGCAATAGCTAGG + Intronic
1107294404 13:38894412-38894434 TCTGGCGTCCAGGAAGAACCAGG - Intergenic
1107880763 13:44830036-44830058 TGTGAGGCCCAGGAATACCTGGG - Intergenic
1111607867 13:90564016-90564038 TCTGGTGTCCAGGAAGAATTAGG - Intergenic
1112603658 13:100882003-100882025 ACTGAGGACCAGGCATAACTGGG + Intergenic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1117611234 14:57485319-57485341 GCTGGTGCCCAGGAATAAGCTGG + Intronic
1117624988 14:57626473-57626495 TCTGGGGTCCAGGGACATCTGGG + Intronic
1117625099 14:57628134-57628156 TCTGGGGTCCAGGGACATCTGGG - Intronic
1118408506 14:65451601-65451623 TCTGGCGCCCAGGAAAAATGAGG + Intronic
1121334623 14:93069694-93069716 CCTGGGGCCGAGGCAGAACTGGG - Intronic
1121829756 14:97039956-97039978 TCTGGGACCCATGAATGTCTGGG + Intergenic
1122417678 14:101558130-101558152 TTTGGTGTCCAGGAACAACTTGG - Intergenic
1122899736 14:104777485-104777507 TCTGGGGCACACGAACACCTGGG + Intronic
1202897271 14_GL000194v1_random:17410-17432 TCTGGGCCCCAGGTATACCCTGG + Intergenic
1123962422 15:25418600-25418622 TGTGGGGGGAAGGAATAACTAGG + Intronic
1126098292 15:45104561-45104583 TCTTGGGCCCAGGGAGAAATGGG - Intronic
1130033492 15:80336937-80336959 TCTGGTCCCCAGGCATAATTTGG + Intergenic
1132975085 16:2707000-2707022 TCTGAGGCCCAGGACTGAGTGGG + Intronic
1133060985 16:3174490-3174512 TCTGGGGTCCTGGAAGAAATAGG + Intergenic
1133598852 16:7319592-7319614 TCTGAGGCCCAGGAAAAGCATGG - Intronic
1135803292 16:25519171-25519193 TCTGGGGAGCAGGAAAAGCTAGG - Intergenic
1136071884 16:27792252-27792274 TCTGGGGTCCAGCAAGGACTTGG - Intronic
1137409528 16:48216072-48216094 TCTGGGGCCCAGCATCAAATGGG + Intronic
1138537347 16:57667057-57667079 TCTGGGGCTCAGGAAGCCCTGGG + Intergenic
1139208519 16:65052989-65053011 TGTGGGACCCAGGAAAAACCTGG + Intronic
1139282225 16:65780692-65780714 TCTGGGGCCCAATAGTAGCTTGG - Intergenic
1141404052 16:83775913-83775935 TCTGGGGCCCAGGAAATATAGGG - Intronic
1141521596 16:84583753-84583775 TCTGAGCCCCAGGACTAACCAGG - Intronic
1143734838 17:8904380-8904402 TCTGTGCCCCAGGAACAAGTAGG - Intronic
1146123913 17:30217428-30217450 ACTGAGGCCCAGGAAGAGCTGGG + Intronic
1148778593 17:50109494-50109516 TCTGGGGCCAGGGAAGGACTGGG - Intronic
1152146745 17:78572991-78573013 TCTGGAGCCCTGGGAAAACTGGG + Intronic
1154354811 18:13616685-13616707 TCTGGGACCCAGGTATCCCTGGG + Intronic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1157154743 18:45254797-45254819 TATGGGGCGCAGGAAGAACGTGG - Intronic
1160759633 19:776731-776753 TCCGGGGCCCAGGGAGAACGAGG - Intergenic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162044513 19:7989586-7989608 TCTGGTGCTCAGGAATATCAAGG + Intronic
1163364644 19:16869206-16869228 TCTGGGGTCCCGGGATGACTTGG + Intronic
1165247289 19:34504935-34504957 TGTGGGGCCCAGGAGAACCTTGG + Exonic
1165712875 19:38024545-38024567 TCTGGGGCCCAGGGCCAGCTGGG - Intronic
1165958200 19:39515203-39515225 CCTGGGCCCCATGAATAACCAGG + Exonic
1166248640 19:41549773-41549795 GCTTGAGCCCAGGAATAAGTTGG - Intronic
1166747749 19:45149811-45149833 GCCTGGGTCCAGGAATAACTTGG - Exonic
1168076741 19:53984510-53984532 TGTGGGGCCAAAGAACAACTTGG + Exonic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925873095 2:8287660-8287682 AATCGGGCCCAGGAAGAACTGGG + Intergenic
927677160 2:25114584-25114606 TCTGGGGCCCAGGACTGCCTAGG - Intronic
928458786 2:31450367-31450389 TCTGGGGCCCTAAATTAACTTGG + Intergenic
928878789 2:36073124-36073146 TTTGGGCCTCAGGAACAACTAGG + Intergenic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
933250616 2:80024871-80024893 TCTGGTGTCCAGGAAGAATTAGG + Intronic
933425969 2:82112633-82112655 TCTGGTGTCCAGGAAGAACTGGG - Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
938154437 2:128920614-128920636 TCTTGGGAACAGGAGTAACTTGG + Intergenic
938195598 2:129324708-129324730 TCAGGGGCCCAGGACTGTCTGGG - Intergenic
943583272 2:189709448-189709470 GGTGGGGCCCAGGAACCACTAGG + Intronic
943991393 2:194697680-194697702 TCTAGAGCCTAGGAATAACATGG - Intergenic
944061956 2:195579224-195579246 GCTTGAGCCCAGGAATAACCAGG - Intronic
1169952177 20:11057299-11057321 TCTGGGGACCTGGAATATATTGG - Intergenic
1174261626 20:49300190-49300212 TCTGTGGCCCAGGATGATCTCGG + Intergenic
1175044144 20:56088237-56088259 TCTTGGGATCAGGAATACCTAGG + Intergenic
1176616955 21:9033399-9033421 TCTGGGCCCCAGGTATACCCTGG + Intergenic
1180089204 21:45525166-45525188 CCTGGGGCCCAGGTCTCACTGGG - Intronic
1180244680 21:46539133-46539155 TCTGGGGCCCAGGACTGTCCAGG + Intronic
1181845669 22:25706919-25706941 GCTGGGGCCAAAGAATTACTTGG - Intronic
1184276905 22:43413880-43413902 CCTGGGGCCGAGAAATAAATAGG - Intronic
1184479989 22:44740788-44740810 GCTGTGGCCCAGGAATCACGAGG + Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
950914429 3:16629332-16629354 CCTGGGGAACAGGAAGAACTGGG - Intronic
950932199 3:16801445-16801467 TCCTGTGCCCAGGAAGAACTGGG - Intergenic
951622123 3:24614296-24614318 TCAGGGACCCAGGATTGACTTGG + Intergenic
951948752 3:28174022-28174044 AATGGGGGCCAGGAATAGCTGGG - Intergenic
953717051 3:45324561-45324583 CCTGGGGCTCAGGATTGACTTGG + Intergenic
956728835 3:72178123-72178145 TCTGGGGCCCAGGGAAAGCACGG + Intergenic
956766748 3:72490781-72490803 TCTGGTGACCAGGACTGACTGGG + Intergenic
959449275 3:106479891-106479913 TCTAGGGCTCAGGAAGAATTTGG + Intergenic
962756457 3:138468797-138468819 TCTGCAGCACAGGAATAACGGGG - Exonic
962958629 3:140289533-140289555 TCTGTGGCACAGCATTAACTGGG + Intronic
963029409 3:140952743-140952765 TCTTGGAACCAGGAATGACTGGG + Intronic
966158908 3:176947723-176947745 TCTGGGGCCCAGGCATACACCGG + Intergenic
966683770 3:182671501-182671523 TCTGTGGCCCTGAAAGAACTTGG + Intergenic
967867991 3:194205946-194205968 GCTGGGGTCCAGGAAACACTGGG + Intergenic
968762308 4:2449107-2449129 TCTGGAGCTCAGGGATATCTAGG + Intronic
969415093 4:7052876-7052898 CCTGGGGCCCAGGAATCTCCAGG - Intronic
969534604 4:7747998-7748020 ACAGGGGCCCAGGAAGCACTGGG + Intergenic
971767398 4:30850758-30850780 TCTGGGGACTAGGAATAAGCAGG - Intronic
972611878 4:40663164-40663186 TCAGGGGCCCATGAAGAAATAGG + Intergenic
972964176 4:44488621-44488643 TATGGAACCCAGGAATAATTAGG + Intergenic
973580396 4:52338946-52338968 GGAGGGGCCCAGGAACAACTGGG + Intergenic
976600959 4:86936587-86936609 TTTGGGGCCGAAGAATACCTAGG + Intronic
977022494 4:91774780-91774802 TCTGGGCCCCATCAATCACTAGG + Intergenic
982884733 4:160764562-160764584 GCTGAGGCACAGGAATCACTTGG - Intergenic
988706946 5:33735827-33735849 TCTGGTGCCCAGGAACATCCTGG + Intronic
990716732 5:58645837-58645859 CCTGGGGCCCACAGATAACTGGG + Intronic
991495372 5:67220633-67220655 TCTGGGGCAGAGCAATAATTTGG + Intergenic
993845848 5:92942242-92942264 ACTGGGGCCTACTAATAACTGGG + Intergenic
996528810 5:124505512-124505534 TCAGGGGTCCAGGAAAACCTGGG - Intergenic
997057730 5:130464593-130464615 TCTGATGACCAGGAATAACAGGG - Intergenic
997453294 5:134000474-134000496 TCTGGATCCCAGGCATACCTGGG + Intronic
997593740 5:135092282-135092304 TATGGGGAAAAGGAATAACTTGG + Intronic
1002055013 5:176593819-176593841 ACAGGGGCCCAGGTATAACACGG + Intronic
1003152187 6:3562273-3562295 TCTGGGGCTCAGGAAGACCCAGG + Intergenic
1003511943 6:6789014-6789036 TCTGGGGAGCAGGAAGAATTGGG + Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1004925684 6:20413057-20413079 TCTGGGCCCCATTAATAAGTGGG + Intronic
1006254276 6:32817260-32817282 TATGGGGCCCTAGAAGAACTAGG + Intronic
1006595756 6:35191777-35191799 CCTGGGGCCAAGGCATCACTGGG + Intergenic
1007615591 6:43178210-43178232 TCTGGGGGCCTGGAATTCCTAGG + Intronic
1010634413 6:78239971-78239993 TCTGGCGTCCAGGAAGAATTAGG - Intergenic
1013899996 6:115143699-115143721 TCTGGGTCCCAGGAAAACATGGG + Intergenic
1016327119 6:142915374-142915396 TGAGGAGCCCAGGAACAACTAGG + Intronic
1016613128 6:146016077-146016099 TCTGTGGCCCAGGGATTACAAGG - Intergenic
1016889649 6:148993280-148993302 GCTGGGGGCCAGGAAGATCTTGG + Intronic
1018612994 6:165661945-165661967 ACTGGGGCTCAGGAAGCACTCGG + Exonic
1019409308 7:899703-899725 TCTGGGGCCCAGGGAGGGCTGGG - Intronic
1020233566 7:6338751-6338773 CCTGGAGGCCAGGAATAGCTTGG - Intronic
1022926427 7:35059578-35059600 TCCAGGGCACAGGAATAACCAGG - Intergenic
1023852293 7:44157246-44157268 TCTGGGCACCAGGAACAGCTTGG - Intronic
1023871007 7:44263064-44263086 TCTGGGGGACAGGAAAAACAAGG + Exonic
1024069500 7:45774447-45774469 TCTGAGGCTCTGGAATACCTGGG + Intergenic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1026930123 7:74219324-74219346 TCAGGGACCCAGCAATGACTTGG - Intronic
1028010079 7:85631116-85631138 TCTGGGACCAAGGAATGAGTAGG - Intergenic
1028387327 7:90271191-90271213 TCTGGGTCCCAGGTCAAACTAGG + Intronic
1031491301 7:122392943-122392965 TCTGTGGGACAGGAATAATTTGG - Intronic
1031821615 7:126509062-126509084 TCTTGCTCCCAGGAATAATTAGG - Intronic
1034334225 7:150310142-150310164 GCTGTAGCCCAGGAATAACCAGG - Intronic
1035526887 8:320735-320757 TCAGGGGCCCAGCAGTAAATTGG - Intergenic
1037309102 8:17536157-17536179 TCAGGGCCCCAGGAATACCAAGG - Intronic
1037823717 8:22148214-22148236 GCTGGGGGCCAGGAGTAGCTGGG + Exonic
1039430430 8:37521348-37521370 GCTGGGGCCCATCAATCACTCGG + Intergenic
1048185754 8:132239083-132239105 TAAGGGGCCCAGGAATTTCTTGG - Intronic
1048503678 8:135001625-135001647 TCAGAGGCCCAGGAGTCACTGGG - Intergenic
1050346618 9:4695171-4695193 TCTGAGTCCCAGGAATCATTAGG + Intronic
1051332281 9:16034860-16034882 TCTGGGCCCAAGGGTTAACTTGG + Intronic
1052220030 9:26009298-26009320 GCTGGGGCCCACCAATCACTGGG + Intergenic
1052343116 9:27382396-27382418 TCAGGGCACCAGGAATAACTAGG - Intronic
1055375129 9:75640648-75640670 TCTGTGGCTCAGGAATACCAGGG - Intergenic
1055465193 9:76558637-76558659 TCTGGAGCCCAGAACAAACTTGG - Intergenic
1055792212 9:79935008-79935030 CCTGGGGGCCAGGTATGACTTGG + Intergenic
1062457582 9:136646759-136646781 GCTGGGGCCCCGGACAAACTGGG + Intergenic
1187733283 X:22278468-22278490 TCAGGGGCTGAGGAAGAACTAGG - Intergenic
1188956447 X:36439768-36439790 TCTGGGGCAAAGAAAGAACTAGG - Intergenic
1189416420 X:40818193-40818215 ACTGCGGCCCAGGAAACACTGGG - Intergenic
1189987812 X:46569768-46569790 CCTGGGCCCCAGGCATAGCTTGG - Intergenic
1190428152 X:50351978-50352000 TCTGGGGCCCAGCCTTGACTAGG - Intergenic
1192210266 X:69123404-69123426 TCTGGGGGCCGGGGATCACTTGG + Intergenic
1195289208 X:103414916-103414938 ACTGGGGACCAGGAATGACCTGG + Intergenic
1201150355 Y:11092250-11092272 TCTGGGCCCCAGGTATACCCTGG + Intergenic