ID: 936518903

View in Genome Browser
Species Human (GRCh38)
Location 2:113199392-113199414
Sequence CGTGCACGCGGGTGTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936518903_936518908 14 Left 936518903 2:113199392-113199414 CCACATGGACACCCGCGTGCACG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 936518908 2:113199429-113199451 GTGTGTGTCCCCACGCACTTAGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936518903 Original CRISPR CGTGCACGCGGGTGTCCATG TGG (reversed) Intronic
900131002 1:1087247-1087269 GGTGCACGTGGGTGTCCCCGTGG - Intronic
901574200 1:10186905-10186927 TGTGCACGTGTGTGTCTATGTGG - Intergenic
902799507 1:18820528-18820550 TGTGCACGCGGGTGTGCGAGGGG - Intergenic
918296679 1:183163604-183163626 CATGCACGCTAGTGTTCATGTGG - Intergenic
924905959 1:248452947-248452969 TGTGGAGGCGGGAGTCCATGTGG - Exonic
924921930 1:248639087-248639109 TGTGGAGGCGGGAGTCCATGTGG + Exonic
1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG + Intergenic
1076184907 10:128438691-128438713 TGTGCACGTGTGTGTGCATGTGG + Intergenic
1076281405 10:129249650-129249672 TGTGCATGGGGGTGTGCATGGGG + Intergenic
1076786350 10:132751839-132751861 CGTGGAGGCGGGTGCCCAGGAGG + Intronic
1077444076 11:2582250-2582272 CCTGCCCGGGGGTGGCCATGGGG + Intronic
1083663287 11:64261982-64262004 AGTCCACGCGGGTGCCCTTGGGG - Exonic
1089195846 11:116693617-116693639 TGTGCATGCGTGTGTGCATGTGG - Intergenic
1090645645 11:128764909-128764931 CCTGCAGGCGGGTGTCCTTAGGG - Intronic
1094311358 12:29087063-29087085 CGTGCACACGGCTGCACATGTGG - Intergenic
1098320731 12:69240222-69240244 CGTGAACGCGGCCTTCCATGAGG - Intronic
1104816320 12:131647981-131648003 CGTGCATGGGGGTGAGCATGGGG - Intergenic
1113883862 13:113647159-113647181 CGGGCACGGGGGTGCCCCTGTGG + Intergenic
1118709283 14:68506544-68506566 CGTGCACGCCGGTGCACACGTGG + Intronic
1140485510 16:75290156-75290178 CAAGCAGGTGGGTGTCCATGGGG - Intergenic
1142134010 16:88443424-88443446 CGTGCATGCGTGTGTGCCTGTGG - Intergenic
1146926163 17:36747269-36747291 CATGCACACGTGAGTCCATGTGG - Intergenic
1147191718 17:38741840-38741862 CATGCAGGCGGCTGTCCATCAGG - Intronic
1149327393 17:55546080-55546102 AGTGCACACAGGTGTGCATGTGG + Intergenic
1149542125 17:57475358-57475380 TGTGCACGCATGTGTCCTTGGGG - Intronic
1152747363 17:82047603-82047625 GGTGCACGTGGGTGTGTATGAGG - Intergenic
1155248946 18:23937517-23937539 CAGGGAGGCGGGTGTCCATGAGG + Intronic
1157174355 18:45437569-45437591 AGTGCAGGCTGGTGTGCATGGGG - Intronic
1158389640 18:57034552-57034574 CGTGCCAGAGGCTGTCCATGAGG - Exonic
1164683420 19:30150902-30150924 TGTGCACACGTGTGTGCATGTGG - Intergenic
1166783049 19:45352250-45352272 CGTGGACGAGGGTGTCCAGGTGG - Exonic
926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG + Exonic
936518903 2:113199392-113199414 CGTGCACGCGGGTGTCCATGTGG - Intronic
946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG + Intronic
948381561 2:237553724-237553746 CTTGCAGGTGGGAGTCCATGTGG - Exonic
948854384 2:240723366-240723388 CCCGCACGGTGGTGTCCATGTGG - Intronic
1171249532 20:23637727-23637749 CCTCCACGCTGGCGTCCATGGGG + Exonic
1175797001 20:61777978-61778000 TGTGCACGTGTGTGTGCATGTGG - Intronic
1175972371 20:62693170-62693192 CCTGCTCACGGGTGTCCCTGAGG - Intergenic
1176045874 20:63092329-63092351 CATGCACGTGAGTGTGCATGTGG + Intergenic
1176097537 20:63351194-63351216 CGTGGACGTGGGTGTGGATGTGG - Intronic
1176097544 20:63351224-63351246 CGTGGACGTGGGTGTGGATGTGG - Intronic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1181558266 22:23684583-23684605 CCTGCAAGCAGGTGTTCATGTGG - Intergenic
1184479226 22:44737287-44737309 TGTGTGCGGGGGTGTCCATGTGG + Exonic
967768245 3:193305890-193305912 CATGCATGCGTGTGTGCATGTGG + Intronic
1006033191 6:31192706-31192728 GGTGCCCTCTGGTGTCCATGTGG + Intergenic
1016987205 6:149904560-149904582 CTTGCAGGAAGGTGTCCATGTGG - Intergenic
1018058943 6:160075112-160075134 CATGCACGTGTGTGTGCATGTGG - Intronic
1018718531 6:166554595-166554617 CTGGCACGCGGGTGGCCATGGGG + Intronic
1019260756 7:80632-80654 CGTGAACAGGGGAGTCCATGAGG - Intergenic
1022410717 7:30136403-30136425 CGTGGGCGCGGGTGACCGTGTGG + Intronic
1026676313 7:72431424-72431446 TGTGCATGCGTGTGTGCATGTGG - Intronic
1034219367 7:149432198-149432220 CGTGCACGCGGGCAAGCATGAGG - Exonic
1034417028 7:150970672-150970694 GGTGCGGGCGGGGGTCCATGGGG - Intronic
1049229041 8:141472698-141472720 CCTGGAGGCGGGTGTCCAGGGGG + Intergenic
1185446362 X:259901-259923 GGTGCACGTGGCTGTCCCTGAGG + Intergenic
1196519893 X:116661069-116661091 CGTGCCCGCGGCTGTCGAGGTGG - Intergenic
1199657271 X:150008704-150008726 CATGCACGCGTGCGTGCATGGGG - Intergenic