ID: 936518903

View in Genome Browser
Species Human (GRCh38)
Location 2:113199392-113199414
Sequence CGTGCACGCGGGTGTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936518903_936518908 14 Left 936518903 2:113199392-113199414 CCACATGGACACCCGCGTGCACG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 936518908 2:113199429-113199451 GTGTGTGTCCCCACGCACTTAGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936518903 Original CRISPR CGTGCACGCGGGTGTCCATG TGG (reversed) Intronic