ID: 936526549

View in Genome Browser
Species Human (GRCh38)
Location 2:113245459-113245481
Sequence ACCAGTGACCAGGGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936526549_936526559 30 Left 936526549 2:113245459-113245481 CCCTCACCCCCCTGGTCACTGGT 0: 1
1: 0
2: 3
3: 19
4: 225
Right 936526559 2:113245512-113245534 AAGCTTCTCCTCATGGACTCTGG 0: 1
1: 0
2: 0
3: 22
4: 239
936526549_936526558 23 Left 936526549 2:113245459-113245481 CCCTCACCCCCCTGGTCACTGGT 0: 1
1: 0
2: 3
3: 19
4: 225
Right 936526558 2:113245505-113245527 CAAGTTGAAGCTTCTCCTCATGG 0: 1
1: 0
2: 0
3: 13
4: 534
936526549_936526557 -2 Left 936526549 2:113245459-113245481 CCCTCACCCCCCTGGTCACTGGT 0: 1
1: 0
2: 3
3: 19
4: 225
Right 936526557 2:113245480-113245502 GTTTTCTATCAGGTTTTAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936526549 Original CRISPR ACCAGTGACCAGGGGGGTGA GGG (reversed) Intronic
900291566 1:1925873-1925895 GCCAGTGCCCATGAGGGTGAGGG + Exonic
900366374 1:2313512-2313534 ACGAGAGACCAGGGGTGTGGAGG + Intergenic
901217829 1:7564708-7564730 CCCAGTGTCCAGTGGAGTGAGGG + Intronic
902513273 1:16977363-16977385 ACCCATGACCAGGGTGGGGAAGG - Intronic
905801881 1:40849440-40849462 AACAGGGACCAGGGGAGTGAAGG + Intergenic
906193072 1:43911223-43911245 ACCAGAGCCCAGGGAGGTCAAGG - Intronic
907408288 1:54267475-54267497 ACCAGTGCACTGGGGAGTGAGGG + Intronic
910246295 1:85142157-85142179 ACCAGAGTCCAGGAAGGTGAGGG + Intergenic
913986547 1:143570825-143570847 AGCAGTGACCAGGGGGGCTTGGG + Intergenic
914582300 1:149029996-149030018 AGCAGTGACCAGGGGGGCTTGGG + Intronic
915553313 1:156647432-156647454 AGGAGTGACAAGGAGGGTGAGGG + Intronic
917203730 1:172546013-172546035 ACCAGTTCCCAGGGAGGTCAAGG - Intronic
918140284 1:181714205-181714227 ACCAGTGGGGAGTGGGGTGATGG - Intronic
918818500 1:189223367-189223389 ACCAGTGACAAGTGGGCTGTAGG + Intergenic
920310200 1:205044089-205044111 ACCAGTGAGGATGGGGGGGAGGG - Intronic
920561479 1:206941964-206941986 AGCAGGGGCCAGGGTGGTGAGGG - Intronic
922236490 1:223726397-223726419 ACTAGTGACCGTGGGGGCGATGG + Intronic
922551217 1:226495866-226495888 CCCAGTGACCAGGGCGGGGCAGG + Intergenic
1064432021 10:15279401-15279423 AGCAGTGCCCAGGTGGGTGAAGG + Intronic
1067524935 10:47032726-47032748 ACCAGGGACCAGGAAGGTTAGGG - Intergenic
1068089192 10:52411645-52411667 CCCAGTGAAGAAGGGGGTGAAGG + Intergenic
1068734390 10:60395741-60395763 CACAGTGACCAGCAGGGTGAGGG - Intronic
1069231850 10:66020382-66020404 AACAGAGACCAGAGGGGTGATGG + Intronic
1070841352 10:79490233-79490255 ACCAGGCACCAGGGAGGTGCTGG - Intergenic
1072187268 10:93051975-93051997 AACAGTGACCTGGGGGCTCAGGG - Intronic
1073463481 10:103679920-103679942 AGCAGTGACAAGGGGGAGGATGG + Intronic
1073691709 10:105816891-105816913 ACCTGTGACCTGGGAGGTTATGG + Intergenic
1074124239 10:110515653-110515675 ACCAGTGACCAACGAGGTGAGGG - Intergenic
1074907915 10:117881276-117881298 ACCCATGACCTGGGGGGTGGAGG - Intergenic
1076379611 10:130015907-130015929 ACCAGTGGCCAGCGGAGGGATGG - Intergenic
1076858407 10:133128379-133128401 ACAGGTGACCAGGGTGATGATGG - Exonic
1077369666 11:2175593-2175615 ACAGGTGACCAGGGGAGTGGGGG + Intergenic
1077908888 11:6557557-6557579 ACCAGTAAGCAGGGGGATGAAGG + Exonic
1083726191 11:64629818-64629840 CCCAGTGTCCAAGGCGGTGAGGG - Intronic
1084098437 11:66928920-66928942 ACCAGGGACAAGGAGGGTCAGGG + Intronic
1084366031 11:68699848-68699870 ACCAGGGGCTAGGGAGGTGATGG + Intergenic
1085589209 11:77741849-77741871 ACCAGGGATTAGGGAGGTGAGGG - Intronic
1087628893 11:100627622-100627644 ACCAGTGCCCAGGCAGATGACGG - Intergenic
1089318073 11:117605650-117605672 ACCAGTGACAAGGAGGTTCAGGG + Intronic
1091755429 12:3048192-3048214 AGCAGTGATGAGCGGGGTGAGGG + Intergenic
1091848868 12:3679090-3679112 AGAAGTGACCTGGGGGGTGCAGG + Exonic
1097607102 12:61768950-61768972 GCCAGTGAGCAGGGGTGAGAAGG - Intronic
1098758210 12:74390818-74390840 TCCTGTGACCATTGGGGTGAGGG + Intergenic
1101049949 12:100851785-100851807 ACCAGAGACCTGTGGGGGGAGGG + Intronic
1101295873 12:103423254-103423276 ACCAGGGGCCAAGGGGGGGAGGG - Intronic
1101416441 12:104512736-104512758 ACCAGTGAAGAGGTGGGAGAGGG + Intronic
1103560999 12:121793342-121793364 TCCAGAGCCCAGCGGGGTGAGGG - Intronic
1108147260 13:47491975-47491997 ACCAGAGGCCATGGGGGTAAGGG - Intergenic
1108727527 13:53199650-53199672 ACCAGTGGCCAGGGTGGTGCAGG - Intergenic
1110562423 13:76923542-76923564 ACCAGAGACCAGGGGCCAGAAGG + Intergenic
1114537836 14:23434043-23434065 ACCTGTGACCAGGGGGTCCAGGG - Intronic
1115325025 14:32128468-32128490 ACCAGAGCCCAGCGAGGTGAAGG - Intronic
1118457948 14:65961766-65961788 ACCAGTGAGCAGGGAGGAGTGGG + Intronic
1121683132 14:95810940-95810962 ACCATTGGTCAGTGGGGTGATGG - Intergenic
1121789759 14:96690305-96690327 ACCAGTTACCAGGGCTGTCAAGG + Intergenic
1122092662 14:99350421-99350443 GCCAGTGCCTAGGGAGGTGAGGG - Intergenic
1122432761 14:101666396-101666418 ACTGGTGACCAGCGGGGTGGTGG - Intergenic
1123126960 14:105953732-105953754 ACAAGTGTCCATGGGGGTCATGG - Intergenic
1123407423 15:20029552-20029574 ACAAGTGTCCATGGGGGTCATGG - Intergenic
1123516750 15:21036208-21036230 ACAAGTGTCCATGGGGGTCATGG - Intergenic
1124962654 15:34410082-34410104 CCCCGTGACCATGGGGGTGCAGG - Intronic
1124979279 15:34556304-34556326 CCCCGTGACCATGGGGGTGCAGG - Intronic
1125564805 15:40668659-40668681 ACCAGTGACTGGGAGGGTAATGG - Intergenic
1125608169 15:40953825-40953847 AACCGTGCCCAGGGGAGTGAGGG + Intronic
1125724690 15:41862334-41862356 ACCAGTGGGCATGGGGGAGAGGG - Intronic
1126838240 15:52689610-52689632 ACTTGTGACCAGGGGAGTTAGGG - Intronic
1127983410 15:64050521-64050543 ACCAGTGCCCCCGGGGGTGGGGG - Intronic
1128787241 15:70406836-70406858 GCCAGTGACCCGGGAGGTGTTGG - Intergenic
1130980366 15:88808148-88808170 GCCAGAGACCAGGGAGCTGAGGG - Intronic
1131029882 15:89177649-89177671 CCCAGTGTCCAGAGGAGTGAAGG - Intronic
1131053373 15:89362239-89362261 ACCAACGACCTGGGAGGTGATGG - Intergenic
1131075139 15:89490772-89490794 TCAGATGACCAGGGGGGTGAGGG + Intronic
1131159134 15:90092998-90093020 ACCAGTGGCCAAGAGGGTGGGGG + Intronic
1131431536 15:92392923-92392945 ACCATTGGCCAGGGGTGGGAAGG - Intergenic
1131887054 15:96927350-96927372 CCATGTGACCAGGGGGTTGAAGG + Intergenic
1132203406 15:99970397-99970419 TCCAGTGTCCAGGGGGCTGTGGG + Intergenic
1132493980 16:251456-251478 ACTAGAGCCCAGGGGGGTGGAGG - Intronic
1132689605 16:1176655-1176677 AGCAGTGAGCAGGGGGCTGATGG + Intronic
1133711072 16:8401646-8401668 AGCAGTGGCCAAGGAGGTGACGG + Intergenic
1134057532 16:11180016-11180038 ACCAGTGACCAGAGAGGTGAGGG - Exonic
1134076412 16:11295014-11295036 ACCAGTGTCCAGGGAGAGGAGGG - Intronic
1134448034 16:14345566-14345588 ACAAGAGACAAGGGGAGTGAGGG - Intergenic
1134624966 16:15717094-15717116 CCCAGTTTGCAGGGGGGTGATGG - Intronic
1134900535 16:17934023-17934045 ACCATTGAACATGGGGGTGCTGG - Intergenic
1135739082 16:24957871-24957893 ACCAGAGTCCACGGAGGTGAGGG + Intronic
1135860298 16:26050087-26050109 CCCAGTCTCCAGGGGGGAGAGGG - Intronic
1136276583 16:29182532-29182554 ACCAGTGACCTGGGAGCTCAGGG - Intergenic
1137359291 16:47798155-47798177 GACTGTGACCAGGGTGGTGATGG + Intergenic
1137554669 16:49463085-49463107 GCCAAAGACCATGGGGGTGAAGG - Intergenic
1137679458 16:50327052-50327074 ATCAGTGACCAGTGTGGTGAAGG + Intronic
1139611772 16:68064119-68064141 CCCAGAAACCAGGGGAGTGAAGG + Intronic
1141615568 16:85207660-85207682 GCCGTTGACCAGCGGGGTGAGGG + Intergenic
1141849180 16:86632474-86632496 ACCAGTAGCCAGGAGAGTGAGGG + Intergenic
1142080965 16:88148593-88148615 ACCAGTGACCTGGGAGCTCAGGG - Intergenic
1142348012 16:89566155-89566177 AGCAGTGCCCACGGGGGTCATGG + Exonic
1142353141 16:89588880-89588902 CCTGGAGACCAGGGGGGTGAGGG - Intronic
1142956963 17:3529012-3529034 ACCAGTCACCATGGAGATGAGGG + Intronic
1142957272 17:3530421-3530443 ACCAGGGACAAAGGGTGTGAAGG + Intronic
1143095264 17:4475467-4475489 ATCAGTGATGAGGGGAGTGAGGG + Intronic
1143369240 17:6428226-6428248 TCCAGTGGCCAGTGGGGTGGGGG + Intronic
1143481534 17:7230039-7230061 AGCAGTGAGCATGGCGGTGAGGG - Exonic
1145257984 17:21338007-21338029 ATCAGTGACAAGGGGGATGGTGG - Intergenic
1145274966 17:21423729-21423751 ACCAGTGACCAGGAGCAGGAAGG + Intergenic
1145282533 17:21478324-21478346 AGCCCTGCCCAGGGGGGTGATGG + Intergenic
1145312820 17:21709629-21709651 ACCAGTGACCAGGAGCAGGAAGG + Intergenic
1145318652 17:21749999-21750021 ATCAGTGACAAGGGGGATGGTGG + Intergenic
1145394941 17:22487431-22487453 AGCCCTGCCCAGGGGGGTGATGG - Intergenic
1146315504 17:31803592-31803614 ACCTGGGACCAGGGAGGTCAAGG + Intergenic
1147125068 17:38361755-38361777 ACCTGTGAACAGGGGGCTGAAGG - Exonic
1149651666 17:58279806-58279828 AGCAGGGACCTGGGGTGTGATGG + Intronic
1152059486 17:78059764-78059786 ACCAGAGCCCAGGGAGGTGAAGG + Intronic
1152626360 17:81389531-81389553 GACAGTGACCAGGGGGCTGGAGG + Intergenic
1153323388 18:3794530-3794552 AGCACTGACCATGGGGCTGAAGG + Intronic
1153798166 18:8644057-8644079 ACCAGAGACCAGGGAGGTCAAGG - Intergenic
1154016527 18:10623539-10623561 TCCAGCTACCAGGGGGCTGAGGG - Intergenic
1155438232 18:25834772-25834794 ACCAGTGGAAAGGAGGGTGAGGG - Intergenic
1156469698 18:37369429-37369451 ACCTTTGCCCAGGTGGGTGAGGG + Intronic
1156489431 18:37487501-37487523 GCCAGTGACCAGGAGGGAGGAGG - Intronic
1159444597 18:68525813-68525835 ACCAGAGGCCAGGGTGGTGTTGG - Intergenic
1159480065 18:68979045-68979067 ACTAGTGACCACTGTGGTGAAGG + Intronic
1160833583 19:1114224-1114246 CCCAGTGACGACCGGGGTGAGGG - Exonic
1161315292 19:3614722-3614744 ACCTGAGACCAGGGAGGTGGCGG - Intronic
1161775634 19:6260627-6260649 ACCAGTCCCCAGGTGGCTGAAGG + Intronic
1161836287 19:6649321-6649343 AGCAGTGGCCAGAGGGGTGGAGG - Intergenic
1163020490 19:14478605-14478627 ACCAGGGACCAAGGGGCTCAGGG + Intronic
1163751719 19:19082062-19082084 GCCAGTGGCCAGGGGAGTGACGG - Intronic
1165112882 19:33512550-33512572 ACAAGTGAGCAGGTGTGTGATGG - Intronic
1165279680 19:34785508-34785530 ACCAGAGAGCAGGGGGCAGAAGG - Intergenic
1165395075 19:35559478-35559500 ACCAGTCCCCAGGGAGGTGCGGG - Intronic
1165724094 19:38100602-38100624 ACCAGTGACCAGGGGGATCCGGG + Intronic
1166269235 19:41703805-41703827 TCCAGTGACCACTGGTGTGAGGG - Intronic
1167467828 19:49659389-49659411 CCCAGGGACCTGGTGGGTGATGG - Intergenic
1167644475 19:50698232-50698254 ACCAGTTACCAGGGGAGACAAGG - Intronic
1168243566 19:55098922-55098944 GCCAGTGCCCAGGCTGGTGAGGG - Intronic
1168636359 19:58000202-58000224 ACCAGTGAGCAGTAAGGTGATGG - Intronic
925119806 2:1409518-1409540 AACACTGAGCAGGTGGGTGAAGG - Intronic
926227594 2:10979266-10979288 CCCAGGGACAAGGGGGTTGAGGG + Intergenic
926780074 2:16462289-16462311 ACCAGTCCCCATGGGGGTCAAGG - Intergenic
928387382 2:30882101-30882123 ACCAGTGCATAGGGGAGTGAGGG - Intergenic
930197709 2:48525916-48525938 ACCTGTGACCAGGGAGGTTGAGG + Intergenic
931327065 2:61237649-61237671 ACCTGAGACCAGGGAGGTCAAGG - Intronic
933667998 2:84980278-84980300 ACCAGTGGCCAGGTGGGTGTTGG + Intronic
933849991 2:86358338-86358360 GCCAGTGCTCAGGGGGGTGGGGG - Intergenic
935396911 2:102619391-102619413 CCCAGTGACCGCGGGGGCGATGG - Intergenic
936526549 2:113245459-113245481 ACCAGTGACCAGGGGGGTGAGGG - Intronic
942970079 2:181948190-181948212 TCCAGAGACCAGTGGAGTGAGGG - Intergenic
946112197 2:217429769-217429791 ACAAGTCCCCAGGGGAGTGAGGG - Intronic
948123365 2:235547133-235547155 AACACAGACCAGGGAGGTGACGG + Intronic
948641457 2:239378277-239378299 AGCGGTGACCAGGGTGGGGAGGG + Intronic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1170989631 20:21290181-21290203 ACCAGATAGGAGGGGGGTGAGGG - Intergenic
1171363000 20:24603383-24603405 GCCATTGAGCAGGGAGGTGAGGG + Intronic
1171524252 20:25797042-25797064 ACCTGGGACCCGGGGGGTGGGGG + Intronic
1171552575 20:26058841-26058863 ACCTGGGACCCGGGGGGTGGGGG - Intergenic
1172619521 20:36309731-36309753 GCCAGTGACCTGGCGAGTGAAGG - Intronic
1174217671 20:48929602-48929624 GGCAGTGAACAGTGGGGTGAGGG + Intronic
1174487241 20:50869244-50869266 CCCAGTGCCCTGGGGGATGAAGG + Intronic
1175343505 20:58251280-58251302 AACAGAGACCAGAGGGGTGATGG + Intergenic
1175415641 20:58799045-58799067 TCCAGTGAACCGGGGGGTGGGGG + Intergenic
1175536809 20:59720474-59720496 ACCAGAGACCATGGTGCTGATGG + Intronic
1176199401 20:63853778-63853800 GACAGGGACCAGGAGGGTGAGGG - Intergenic
1176199424 20:63853858-63853880 GACAGGGACCAGGAGGGTGAGGG - Intergenic
1176199435 20:63853898-63853920 GACAGGGACCAGGAGGGTGAGGG - Intergenic
1176199446 20:63853938-63853960 GACAGGGACCAGGAGGGTGAGGG - Intergenic
1176920159 21:14678585-14678607 ACCAGTGAGCAAGGAGGAGAAGG - Intergenic
1179586475 21:42376749-42376771 TGCTGAGACCAGGGGGGTGAGGG + Intronic
1182030968 22:27159174-27159196 GCGAGTGAACAGAGGGGTGAGGG + Intergenic
1182276684 22:29194001-29194023 AACACTGGCCAGGGGGGTGGTGG - Intergenic
1182513989 22:30842027-30842049 ACCTGAGCCCAGGGAGGTGAAGG - Intronic
1182517933 22:30869616-30869638 ACCTGAGCCCAGGGAGGTGAAGG - Intronic
1182599461 22:31449407-31449429 ACCTGTGACAAGGGAGGAGAGGG + Exonic
1182825576 22:33262178-33262200 ACCACTGAACAGCCGGGTGACGG - Intronic
1183830795 22:40417517-40417539 ACCAGTGGCCAGGGGGCTGGGGG + Intronic
1184778761 22:46635794-46635816 TCCAGTGGCCGGGGGGGTGGGGG - Intronic
949141889 3:643949-643971 AGAAGTGACCAGGGTAGTGAGGG - Intergenic
949403772 3:3693619-3693641 ACCAGTGAGGAGGAGGGTGATGG - Intergenic
950273062 3:11634602-11634624 ACCAGTGAAGAGGGGCTTGATGG - Intronic
952981255 3:38738021-38738043 ACCTGAGACCAGGGAGGTGGAGG - Intronic
953391518 3:42536401-42536423 ACCAGAGACCAGGGGGCCGGGGG - Exonic
958098100 3:88973651-88973673 ACCAGAGTCCAGTGGGGTGTGGG - Intergenic
960641269 3:119825956-119825978 ACTAGTGACCTGGGAGGAGATGG - Intronic
961445461 3:126978955-126978977 CCCAGTGACCAGGGATCTGAGGG + Intergenic
961548744 3:127654485-127654507 ACTAGGAACCAGTGGGGTGAGGG - Intronic
962267724 3:133955478-133955500 ACCAGTGCCCATGGAGGAGAAGG - Intronic
963087693 3:141453818-141453840 ACCCCTGACCAGGGGGTTAAGGG + Intergenic
963813032 3:149798493-149798515 ACCACTTACAAGGGGTGTGAAGG + Intronic
966340902 3:178924102-178924124 AACACTGACCAGGGGGGGGATGG - Intergenic
966621971 3:181974986-181975008 ACCAGAGACTAGGGAGGGGATGG - Intergenic
968503142 4:960399-960421 ACCAGTCTCCAGTGGGATGAGGG + Exonic
968914303 4:3490516-3490538 ACGAATGAGCGGGGGGGTGAAGG - Intronic
969940736 4:10728541-10728563 ATCAGTGACCACTGAGGTGATGG - Intergenic
970675236 4:18441369-18441391 ACCAGTGATCAGAGGGAGGAGGG + Intergenic
977442066 4:97080352-97080374 ACCAGGGGAGAGGGGGGTGAGGG - Intergenic
980519308 4:133910205-133910227 ACAGGTCACCAGGGGAGTGAGGG + Intergenic
984288068 4:177759165-177759187 TCCATGGACCTGGGGGGTGAAGG + Intronic
984764772 4:183391675-183391697 GCCAGTGGCAAGGGTGGTGAAGG - Intergenic
985027543 4:185753051-185753073 ACCAGTGACCACGGCCATGAGGG + Intronic
987295679 5:16548800-16548822 ATCAGACACCAGGGTGGTGAGGG + Intronic
987611052 5:20203278-20203300 ACCAGAGACCAGGGGGTCAATGG + Intronic
991027637 5:62047756-62047778 ACAGCTGACCAGGGAGGTGATGG - Intergenic
991687387 5:69193937-69193959 ACGTGTGGCCAGGGGTGTGATGG - Intronic
992045435 5:72883825-72883847 ACCAGAGCCCAGGGAGGTCAAGG - Intronic
992158323 5:73976413-73976435 ACCACTGACCAGCTGGGTTAAGG - Intergenic
993388945 5:87294423-87294445 CCCAGTTACCTGGGAGGTGAAGG - Intronic
995358863 5:111270426-111270448 ACCAGGGACAAGGGAGTTGAAGG - Intronic
1000478727 5:161744696-161744718 GCCAGTGACCTGGGGGATGGGGG - Intergenic
1000937963 5:167326056-167326078 AACGGTGGCCAGGAGGGTGAGGG + Intronic
1002402168 5:178996840-178996862 ACCTGTGAGCAGGGGGCTGGAGG + Intergenic
1002542171 5:179913576-179913598 TCCAGTGACCATGGAGGGGAAGG - Intronic
1003507433 6:6751415-6751437 ACCAGTGAGCAGGTGGCTGGAGG - Intergenic
1005690778 6:28303249-28303271 ACAAGTAACCAGGAGAGTGAAGG + Intergenic
1005943388 6:30578181-30578203 ACCAGTGATGAGGAGGATGAAGG + Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1016799843 6:148157457-148157479 AGCAGTCACCAGGATGGTGAAGG + Intergenic
1019537846 7:1538316-1538338 GCCAGAGACCAGGGAGGTGGGGG - Intronic
1019923903 7:4179989-4180011 ACCAGGAACCAGGGGGCTCAGGG + Intronic
1025016338 7:55441717-55441739 ACCAATGACCTGGGGGGTGAGGG - Intronic
1026621526 7:71953841-71953863 ACCTGTCTCCTGGGGGGTGAGGG + Intronic
1026927743 7:74205680-74205702 ACCAGTGCCCAGGCCCGTGAAGG + Intronic
1032484212 7:132271473-132271495 ACCAGTAACCACTGGGGTGGAGG - Intronic
1034458938 7:151187445-151187467 AGCAGCCACCAGAGGGGTGAGGG - Intronic
1036066275 8:5384546-5384568 ACCTGAGCCCAGGGAGGTGAGGG - Intergenic
1037443097 8:18937501-18937523 ACCTGTCTCCAGTGGGGTGATGG - Intronic
1039102103 8:33951689-33951711 ACCTGGGACCAGGGAGGGGAGGG + Intergenic
1042461551 8:69074812-69074834 ACCAGTGCCCAGGGAGGTCGAGG - Intergenic
1047311009 8:123691991-123692013 ACAAGAGACCAGGGGAGTGCAGG + Intronic
1048235269 8:132683577-132683599 GCCAGTGCCCCTGGGGGTGAAGG + Intergenic
1048599534 8:135905172-135905194 ACCAGTGACCAGGGTTTTCATGG + Intergenic
1048944770 8:139434151-139434173 ACCAGTGACTACAGGGGTTATGG + Intergenic
1049154128 8:141056597-141056619 GCCAGTGACCTGGGTGGTGTGGG + Intergenic
1051383055 9:16478299-16478321 ACTCATGACCAGGGTGGTGAAGG - Intronic
1054160011 9:61667064-61667086 ACCTAGGACCCGGGGGGTGAGGG - Intergenic
1054447812 9:65386244-65386266 ACCTGGGACCCGGGGGGTGGGGG - Intergenic
1056209895 9:84355895-84355917 ACCTGAGACCAGGGAGGTCAAGG - Intergenic
1056549122 9:87636585-87636607 AACACTGACCTGGAGGGTGAAGG + Intronic
1056666315 9:88583465-88583487 ACCAGAGACCAGCGGGGTGATGG - Intronic
1057779801 9:98040343-98040365 ACCAGTGGCCATGGGGATCAGGG - Intergenic
1058708014 9:107653353-107653375 ATGAGTGACCAGGAGGGTGGAGG - Intergenic
1059141966 9:111861897-111861919 ACCTGAGCCCAGGGGGGTTAAGG + Intergenic
1059526172 9:114992870-114992892 ACCTGTGACTAAGGGGGTGGGGG - Intergenic
1060157420 9:121329304-121329326 ACCTGGGACCAGGTGGGTGAAGG + Exonic
1060279404 9:122205941-122205963 AGCAGTGGCCAGGGTGGGGAAGG - Intronic
1061160643 9:128892111-128892133 ACCAGAGCCCAGCGAGGTGAAGG + Intronic
1192144590 X:68673078-68673100 CCAAGTGGCCAAGGGGGTGAAGG - Intronic
1192432080 X:71119184-71119206 CCTAGTGACCATGGGAGTGAGGG + Intronic
1192755436 X:74042294-74042316 ACAACTTACCAGGGAGGTGAAGG - Intergenic
1195906368 X:109848535-109848557 ACCAGAGACCAGGTGGTTGGTGG - Intergenic
1200795314 Y:7336198-7336220 ACCACTGACCAGCAGGGAGAAGG - Intergenic