ID: 936528700

View in Genome Browser
Species Human (GRCh38)
Location 2:113259897-113259919
Sequence CTGCGTTTGGGGAGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936528689_936528700 10 Left 936528689 2:113259864-113259886 CCCTCTGGGCTGCAGAAGGAAGG 0: 1
1: 1
2: 1
3: 44
4: 327
Right 936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG 0: 1
1: 0
2: 4
3: 30
4: 221
936528685_936528700 27 Left 936528685 2:113259847-113259869 CCAGGGCTGTGGAAGGGCCCTCT 0: 1
1: 1
2: 2
3: 32
4: 313
Right 936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG 0: 1
1: 0
2: 4
3: 30
4: 221
936528691_936528700 9 Left 936528691 2:113259865-113259887 CCTCTGGGCTGCAGAAGGAAGGT 0: 1
1: 0
2: 2
3: 24
4: 305
Right 936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG 0: 1
1: 0
2: 4
3: 30
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936528700 Original CRISPR CTGCGTTTGGGGAGGGAAAC AGG Intronic
900341484 1:2191379-2191401 CTGCGTGTGGGCAGGGGAGCAGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
900843949 1:5081033-5081055 CTGCCTCTGGGAAGAGAAACTGG + Intergenic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
902569335 1:17336873-17336895 CTGCATTTCGGGAGGGATACAGG - Intronic
902650450 1:17833849-17833871 CTGTGCATGGGGAGGGAAAGGGG + Intergenic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904447490 1:30586969-30586991 CGGCGTTTGGGGAAGGCACCTGG - Intergenic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905598431 1:39229467-39229489 CTGGGCTTGGGGAGAGAACCTGG + Intronic
905737171 1:40337561-40337583 GTGGGGTTGGGGAGGGAAACCGG - Intergenic
907117467 1:51981425-51981447 ATGCCTCTGGGGAGGGGAACTGG - Intronic
907459776 1:54598526-54598548 CTGCGTCTGGGGATGGGACCAGG + Intronic
909052345 1:70781456-70781478 ATGCGGTTGGGGTGGGAGACAGG - Intergenic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915254816 1:154619203-154619225 CTGGGGCTGGGGAGGGAACCTGG - Intronic
915638283 1:157201681-157201703 TTGCCTCTGGGGAGAGAAACTGG - Intergenic
915934567 1:160083147-160083169 CTGCAAATGGGGAGGGGAACTGG - Intronic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
916544963 1:165795315-165795337 CTGCCTTTGGGGAGGAACAATGG + Intronic
920874934 1:209826101-209826123 CTGCCTCTGGGGAGGGAAACTGG + Intergenic
920964810 1:210692962-210692984 CTCCGTTAGGGGAGGGAGACAGG - Intronic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923649838 1:235864178-235864200 CTGCAGTAGGGGAGGGAGACTGG - Intronic
923883100 1:238125136-238125158 CTTCCTTTGTGGAGGGGAACTGG - Intergenic
924141374 1:241027261-241027283 CAGGGAGTGGGGAGGGAAACTGG + Intronic
1062972862 10:1661891-1661913 CTGCTGCTGGGGAGGGAAAGGGG + Intronic
1063338986 10:5245080-5245102 CTGCTTCTGGGGAGGGCCACAGG - Intergenic
1063344112 10:5295287-5295309 CTGCTTCTGGGGAGGGCCACAGG + Intergenic
1068618952 10:59156378-59156400 CGGAGTTTTGGGAGAGAAACTGG - Intergenic
1068852428 10:61759358-61759380 CTGACTTGGGGGAGGGAAAGGGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070809068 10:79288497-79288519 GTGTGTTGGGGGAGGGAAATTGG - Intronic
1072307232 10:94119467-94119489 GTGAGTTTGGGGAGATAAACAGG - Intronic
1072740295 10:97905084-97905106 ATGGGTTGGGGGAGGGAGACTGG + Intronic
1073168582 10:101481261-101481283 CTGCTTTTGTGCATGGAAACAGG + Intronic
1073539253 10:104305071-104305093 CTGCAGTTGGGGAGGGAGATTGG + Intergenic
1074721669 10:116270773-116270795 CTGCCTTCGGGGAGGGACACGGG + Intronic
1074897693 10:117791374-117791396 CAGAAGTTGGGGAGGGAAACAGG - Intergenic
1076452236 10:130564856-130564878 CAGCTGTTGGGGAGGGAAACGGG - Intergenic
1077519347 11:3022606-3022628 CTGCCTCTGGGGAGAGAGACAGG - Intronic
1078374748 11:10784443-10784465 CTGCGTTTGTGAAGGGGACCTGG - Intergenic
1079334964 11:19563282-19563304 CTGTGTTTGGGAAGAGAGACTGG - Intronic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1084415230 11:69028345-69028367 CTGAGTTTGGAGAGGAAAGCAGG - Intergenic
1085214880 11:74820615-74820637 GTGTGTTTGGGGAGGGATTCAGG + Intronic
1085442151 11:76575038-76575060 CAGGGTTTGGGCAGGGAGACAGG + Intergenic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1092069302 12:5619841-5619863 CTGCAGCTGGCGAGGGAAACTGG + Intronic
1092092814 12:5817787-5817809 CTGCAATTGGTGAGAGAAACAGG + Intronic
1094766117 12:33596553-33596575 CTGCGGTTGGGGAGGAGAAAGGG + Intergenic
1095159973 12:38905121-38905143 CCGGGTTTGGGGCGGAAAACCGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097909894 12:64958569-64958591 TTGCCTCTGGGGAGGGAAAATGG - Intergenic
1097910015 12:64959470-64959492 TTGCCTCTGGGGAGGGAAAATGG - Intergenic
1102361727 12:112293736-112293758 TTGCCTCTGAGGAGGGAAACTGG + Intronic
1103875630 12:124125035-124125057 GTGCTTTTGGGGAGGGAGACAGG + Intronic
1104348234 12:128021810-128021832 TTGCTTTTGGGGAGGAAAGCAGG - Intergenic
1105714785 13:23052377-23052399 CTGAGTTTGCCAAGGGAAACAGG - Intergenic
1106539783 13:30680003-30680025 CTGTGTGTGGGTAGGGACACCGG + Intergenic
1110654416 13:77980043-77980065 CAGCTTTTGGAGAGGGGAACAGG + Intergenic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1114472714 14:22974776-22974798 CTGCCTTTGGGGAGGGGATAGGG - Intronic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1115935447 14:38547346-38547368 AGGCGTTTAGGGAGGCAAACTGG + Intergenic
1117316877 14:54579756-54579778 CTGGGCTTGAGGAGGGAAACAGG + Intronic
1117531096 14:56661341-56661363 CTGCTTCTGGGTAGGGAACCAGG + Intronic
1118665066 14:68059639-68059661 CTACTTTTGGCCAGGGAAACAGG - Intronic
1119663489 14:76467582-76467604 TTGTGTTTGGGGAGGCAGACTGG + Intronic
1119917995 14:78420070-78420092 CTGCTTTTGGGCAGGGAAGATGG + Intronic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121968957 14:98338867-98338889 CTAAGATTGGGGAGGGAAATGGG + Intergenic
1122101871 14:99418902-99418924 CTGCATTTGGGGGTGGAAAGGGG - Intronic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1128781439 15:70361381-70361403 CTGCCTTTGGGGTGAGCAACAGG - Intergenic
1129825375 15:78631327-78631349 CTCATTCTGGGGAGGGAAACGGG + Exonic
1133610966 16:7432971-7432993 CAGCTTCTGTGGAGGGAAACAGG + Intronic
1135035376 16:19072611-19072633 CTGGGTTTGGGTAAGGAACCGGG + Intronic
1137932770 16:52604340-52604362 CTCCATTTGGGGAGGGGAACAGG - Intergenic
1140857216 16:78988699-78988721 GTGCATTTGGGTAGGGAAATGGG + Intronic
1141241874 16:82272385-82272407 CTAGGTATGGGGAGGGAAAGTGG + Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141869199 16:86773092-86773114 CTGCGTTTTGGGAGAGGAGCAGG + Intergenic
1142255950 16:89014048-89014070 CTGCATTTGGGGAGGAAAAGGGG + Intergenic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1143478849 17:7217463-7217485 CTGGGGTGGGGGAGGGGAACTGG + Intronic
1144459989 17:15450894-15450916 CTGGGTTTGGGGAGGATAATGGG - Intronic
1148168166 17:45498479-45498501 TTGCCTTCGGGGAGGGAAACTGG - Intergenic
1148280649 17:46344481-46344503 TTGCCTTCCGGGAGGGAAACTGG + Intronic
1148302877 17:46562416-46562438 TTGCCTTCCGGGAGGGAAACTGG + Intronic
1148366975 17:47062757-47062779 TTGCCTTCGGGGAGGGAAATTGG + Intergenic
1150399352 17:64844896-64844918 TTGCCTTCGGGGAGGGAAACTGG - Intergenic
1152531151 17:80920002-80920024 CTGGGTTTGGAGATGCAAACTGG - Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156819852 18:41359174-41359196 CTGCGTCTGGTGAGGGCATCAGG - Intergenic
1156838706 18:41585988-41586010 CTGCGTTTGGAGAGGAAAGGAGG + Intergenic
1157286773 18:46382260-46382282 CTGCATCTGGGGAGGAAATCAGG + Intronic
1161322145 19:3646234-3646256 CTCCCTCTGGGGAGGGAGACTGG + Intronic
1161489108 19:4552187-4552209 CTGCCTTTGGGGAGAGGAGCAGG - Intronic
1161621040 19:5297184-5297206 CTGCCCTTGGGGAGGAACACGGG + Intronic
1161657740 19:5526193-5526215 CTGCCCCTGGGGAGGGAACCTGG + Intergenic
1163551715 19:17969234-17969256 CTGCTTTCTGGGAGGGGAACTGG - Intronic
1165433570 19:35785166-35785188 CTGCGGTTTGGGGGAGAAACAGG - Intronic
1165454647 19:35903632-35903654 TTGCGCTTGGGGAATGAAACGGG - Intronic
1166058695 19:40310812-40310834 CTGCCTCTGGAGAGGGGAACTGG + Intergenic
1168187327 19:54708598-54708620 CTGGGTTTGGGGAGGGTCCCTGG - Intergenic
926266628 2:11328298-11328320 CTACATTTGGGGGGGGAAACAGG + Intronic
927493675 2:23537732-23537754 CTGCATGTCGGGTGGGAAACTGG + Intronic
927894404 2:26772129-26772151 CTGAGTTTGCGGAAGAAAACAGG - Intronic
930472032 2:51829174-51829196 CAGCATTTGGGGAGGCAAAGAGG + Intergenic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
931738714 2:65222522-65222544 CAGAGTCTGGGAAGGGAAACTGG + Intergenic
932095271 2:68841919-68841941 CTGCTATTGGTGGGGGAAACAGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
934972046 2:98771563-98771585 CTGCTTCTGGGGAGAGAAACAGG + Intergenic
936471158 2:112799671-112799693 CTGGGTTTGAGGAAGGAAACTGG + Intergenic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
938118528 2:128618269-128618291 CTGCATTTGGGGAGGGCCTCGGG - Intergenic
938883331 2:135615381-135615403 TTGGGTTTGGGGAGGAAAATTGG + Intronic
942007804 2:171724401-171724423 CTGCCATTGGGGAGAGACACAGG + Intronic
943633010 2:190275254-190275276 ATTCAGTTGGGGAGGGAAACAGG + Intronic
944187657 2:196967299-196967321 CTGCGGTTGGGGAAGGGAAAGGG - Intronic
947342313 2:229152861-229152883 TTGGGTTTGGGGAGGGAAAGAGG - Intronic
948159555 2:235812884-235812906 CTGCTTCTGGGGAGCAAAACGGG - Intronic
948347696 2:237312971-237312993 CTGCCTTTCGGGATGGACACAGG - Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
1168991802 20:2102236-2102258 CCGCGCTTGGGAAGGGAAATCGG + Intronic
1170765476 20:19286266-19286288 CTGCAGTTGACGAGGGAAACCGG + Intronic
1171205830 20:23280196-23280218 CTGGGTCTGGAGATGGAAACAGG - Intergenic
1171525223 20:25803833-25803855 ATGTGTTCGGGGAGGGAATCAGG + Intronic
1171551604 20:26052051-26052073 ATGTGTTCGGGGAGGGAATCAGG - Intergenic
1171792727 20:29543354-29543376 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1171855743 20:30341048-30341070 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1171964478 20:31518995-31519017 CTGCCTCTGAGGAGGGAAATAGG - Intronic
1173381601 20:42549432-42549454 GTGGGGTTGGGGAGGGACACGGG + Intronic
1174199378 20:48796514-48796536 CTGCCTCTGGGGAGGGAACTTGG + Intronic
1175454118 20:59096976-59096998 TTGCATTTGGGGAGGGAGAGAGG + Intergenic
1175506810 20:59491962-59491984 GTGTAGTTGGGGAGGGAAACAGG - Intergenic
1176214833 20:63943070-63943092 CTGCCCTTGGGGAGGGACAGTGG + Intronic
1179731888 21:43372693-43372715 CGGGGTCTGGGGAGGGAACCAGG + Intergenic
1180726357 22:17949498-17949520 CACCGTTTGGGGAGGGGCACAGG - Intronic
1180949638 22:19715242-19715264 TTGTGTATGGGGAGGGAAAGGGG - Intronic
1181602815 22:23962090-23962112 CTCCCTATGGGGAGGTAAACGGG + Intergenic
1181605699 22:23979217-23979239 CTCCCTATGGGGAGGTAAACGGG - Intronic
1181972620 22:26703735-26703757 TTGCTTGTGGGGAGGGCAACTGG + Intergenic
1185020423 22:48371409-48371431 CTGAGTCTGGGGAGAGATACAGG - Intergenic
950086733 3:10264131-10264153 CTGAGTATGAGGAGGGAATCTGG + Intronic
950374905 3:12563323-12563345 CTGCTTTTGGGGAGAGAAACAGG + Intronic
952385302 3:32837113-32837135 TTACATTTGGGGAGTGAAACTGG - Intronic
952929072 3:38346086-38346108 CTGGGTTTGGGGAGGAATTCTGG + Intergenic
953005656 3:38976827-38976849 CTGGGTTTGGGTAGGGGGACGGG - Intergenic
953865780 3:46582029-46582051 CTGCGTGTGTGCAGGGAGACTGG + Exonic
954114806 3:48460565-48460587 CTGCTGCTGGGGAAGGAAACAGG + Exonic
954641876 3:52105470-52105492 CTGCCCCTGGGGAGGGAAGCAGG + Intronic
955411716 3:58659728-58659750 TTCCGTTTGGGAAAGGAAACTGG + Intronic
956626846 3:71275022-71275044 ATGCCTTTGGGAAGGGAAACTGG - Intronic
957270700 3:78026751-78026773 TTGCTTCTGGGGAAGGAAACTGG + Intergenic
960930436 3:122843039-122843061 CTGGGTTGGGGGAGGGAAATGGG - Intronic
961187049 3:124924679-124924701 TTGCCTCTGGGGAAGGAAACTGG + Intronic
961637881 3:128344471-128344493 CTGCCTTTGGGGAGGGGACCTGG - Intronic
963812168 3:149788718-149788740 TTGCATCTGGGGAGGGAAACTGG + Intronic
964503521 3:157374050-157374072 CTGCGTTAAGGGAGGACAACTGG + Intronic
965733042 3:171792567-171792589 CTGGGGCTGGGCAGGGAAACAGG - Intronic
970556882 4:17242866-17242888 CTGAGTGTGGGGAGGAAAAGGGG - Intergenic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
973875890 4:55218113-55218135 CTGATTTTGAGGAGGGAGACCGG - Intergenic
976966836 4:91053649-91053671 TTGCATCTGGGGATGGAAACTGG - Intronic
978419218 4:108512145-108512167 CTATGTTTGGGGAGGCAAAGTGG - Intergenic
981723766 4:147826872-147826894 CGGGGCTTGGGGAGGGAAAGAGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986746301 5:10747926-10747948 CTGGGTGTGGGGTGGGGAACAGG + Intronic
987876855 5:23690748-23690770 CCGAGTGTTGGGAGGGAAACAGG + Intergenic
990261008 5:54022368-54022390 CTGCACTTTGGGAGGGAAAGAGG - Intronic
992752150 5:79871656-79871678 CTGCCTCTAGGGAGGGGAACTGG - Intergenic
993462108 5:88195773-88195795 ATGCTTTAGGGGAGGGAAAGGGG - Exonic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994692538 5:103035539-103035561 CTGCGTTTGGTGAGGGTCTCAGG + Intergenic
996702069 5:126460253-126460275 GTGCCTTTGTGGAGAGAAACTGG + Intronic
996805932 5:127453929-127453951 GTGGGTGTGGGGAGGGAAATAGG - Intronic
997409822 5:133682368-133682390 CTGCGTTCGAGGAGTAAAACAGG - Intergenic
997409967 5:133683596-133683618 CTGCGTTTGGAGCTGGAAACAGG - Intergenic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
997904343 5:137800219-137800241 ATGTATTTGGGTAGGGAAACAGG + Intergenic
999247795 5:150164545-150164567 CTGAGTCTGGGGAGGAAGACAGG - Intergenic
999613857 5:153400969-153400991 CTGGGCTTGGGAAGAGAAACAGG - Intergenic
1000353020 5:160367306-160367328 CTGCATTTGGGCAGGTCAACAGG + Intronic
1000850073 5:166329256-166329278 CTGAGGTTGGGGCGGGGAACTGG - Intergenic
1006622837 6:35378543-35378565 CTGAGTTTGGGAAGGGAATGTGG - Intronic
1007319774 6:41019170-41019192 CTGCCTTTTGGGAAGGTAACAGG + Intergenic
1007960199 6:45951872-45951894 GTGTGTTTGGGGAGGGACATGGG - Intronic
1009882524 6:69586218-69586240 CTGCAATTAGGGAAGGAAACTGG - Intergenic
1010041264 6:71387585-71387607 CAGAGTTTGAGGAGAGAAACTGG + Intergenic
1011345693 6:86367777-86367799 CTGCTTTTGGTGAGGGACTCAGG - Intergenic
1017353949 6:153480071-153480093 CTGACTTTAAGGAGGGAAACTGG - Intergenic
1018798289 6:167203780-167203802 CTGAGTCTGGGGAAGGAATCAGG - Intergenic
1018814423 6:167320396-167320418 CTGAGTCTGGGGAAGGAATCAGG + Intergenic
1019544172 7:1565230-1565252 CTGCGTTTGGGGGGGCCACCAGG - Intergenic
1019781230 7:2941096-2941118 ATGTGTTTGGGGAGGAACACAGG - Intronic
1019965379 7:4494515-4494537 CTGAGTTTGGGGTTAGAAACAGG + Intergenic
1021524861 7:21575690-21575712 ATGCCTTTGGGGAGGAAAAATGG - Intronic
1024278294 7:47697160-47697182 CTGCTTTTGGGGAGGGCCTCAGG + Intronic
1024735132 7:52296401-52296423 CTGCGGTCTGGGAGGAAAACTGG + Intergenic
1027145620 7:75692147-75692169 CTGCCTTTGGGGAGTGGAATTGG - Intronic
1029949912 7:104573087-104573109 ATTCATTTGGGGAGGGAAAATGG + Intronic
1032117665 7:129130292-129130314 CAGCCTCTGGGGAAGGAAACTGG - Intergenic
1032436361 7:131904190-131904212 CTGCCTTGGGTGGGGGAAACAGG + Intergenic
1036124609 8:6051595-6051617 CTGCTTTTGGGAAGGGAAGCTGG - Intergenic
1037899649 8:22680258-22680280 TGGGGTTTGGGGAGGGATACGGG - Intergenic
1039627464 8:39068726-39068748 CAGCATTCTGGGAGGGAAACAGG + Intronic
1039888111 8:41666961-41666983 CAGCCTTTGGTGAGGGGAACTGG - Intronic
1040530158 8:48260482-48260504 CGGCTTTCGGGCAGGGAAACGGG + Intergenic
1042816554 8:72883647-72883669 ATGGGATTGGGGAGGGATACTGG - Intronic
1047935003 8:129767679-129767701 CCGTGTTTGGGTAGGGACACAGG - Intronic
1048471354 8:134707053-134707075 CTGAGTTTGGGGAGGGGCATGGG - Intronic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1053400893 9:37821013-37821035 TTGCCTTTGGGGAGGGAAACTGG - Intronic
1053554014 9:39115801-39115823 CTGAGTTTGAGGAGGGGAATGGG - Intronic
1053793563 9:41704341-41704363 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1054151615 9:61610489-61610511 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1054181974 9:61916356-61916378 ATGTGTTCGGGGAGGGAACCGGG + Intergenic
1055828240 9:80352375-80352397 CTGTCTTTGGAGAGGGGAACTGG + Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059437703 9:114286441-114286463 CTGCTTTTGGTTAGGGAAGCAGG - Intronic
1060925842 9:127454591-127454613 ATGTGTTTGGTGAGGGAAAGTGG + Exonic
1061395726 9:130342443-130342465 CTGCGTCTGGGGAGGGACTGGGG + Intronic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1185481175 X:447507-447529 CTGGGAATGGGGAGGGAAAATGG - Intergenic
1186300254 X:8193035-8193057 TTGCCTTTGGAAAGGGAAACAGG - Intergenic
1186664572 X:11704357-11704379 CAGTGTTTGGGGAAGGAAATCGG + Intergenic
1187319665 X:18228122-18228144 CTGCGTTTGGGTGGGGGAACCGG + Intergenic
1187462512 X:19500576-19500598 CTTGGTTTGGGGAGGGAGAGTGG - Intronic
1189481660 X:41396661-41396683 CTGCCTTTGGGGAGGGACCCAGG - Intergenic
1189819176 X:44853624-44853646 CTGCCTTTGGGGAGGGGAACTGG - Intergenic
1192125299 X:68496266-68496288 TTGCCTGTGGGGAGAGAAACTGG - Intergenic
1192797092 X:74432938-74432960 TGGCCTTTAGGGAGGGAAACAGG - Intronic
1193151449 X:78128842-78128864 TTGCTTCTGGGGAGGGAAACTGG - Exonic
1193751255 X:85347500-85347522 CTGCTTCTGGGAAGAGAAACTGG + Intronic
1194339716 X:92693556-92693578 CTGCATTTGGAGATGGTAACAGG + Intergenic
1195975573 X:110522477-110522499 CTGCGTGTGTGCAGGGAGACTGG + Intergenic
1196539867 X:116895144-116895166 ATAGGGTTGGGGAGGGAAACTGG - Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1196950265 X:120869850-120869872 CTGCGGCTGGGAAGGGAGACAGG - Intergenic
1198620229 X:138499663-138499685 ATGGGTTTGGGGAGGGCAAAGGG + Intergenic
1198911573 X:141620759-141620781 CTGGGGTAGGTGAGGGAAACTGG - Intronic
1199255271 X:145712337-145712359 CTGGGGTTGGGGATGGGAACAGG - Intergenic
1200648102 Y:5810339-5810361 CTGCATTTGGAGATGGTAACAGG + Intergenic