ID: 936529194

View in Genome Browser
Species Human (GRCh38)
Location 2:113263603-113263625
Sequence GGCATGTGCACAGCCAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936529186_936529194 18 Left 936529186 2:113263562-113263584 CCCCATTTTATAGATAAAGATGC 0: 2
1: 6
2: 51
3: 474
4: 2583
Right 936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG 0: 1
1: 0
2: 0
3: 12
4: 149
936529192_936529194 -4 Left 936529192 2:113263584-113263606 CCATCTCGGAGGCTCAAATGGCA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG 0: 1
1: 0
2: 0
3: 12
4: 149
936529187_936529194 17 Left 936529187 2:113263563-113263585 CCCATTTTATAGATAAAGATGCC 0: 1
1: 1
2: 15
3: 195
4: 1390
Right 936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG 0: 1
1: 0
2: 0
3: 12
4: 149
936529188_936529194 16 Left 936529188 2:113263564-113263586 CCATTTTATAGATAAAGATGCCA 0: 1
1: 0
2: 13
3: 145
4: 983
Right 936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936529194 Original CRISPR GGCATGTGCACAGCCAGTTA GGG Intronic
901039846 1:6357352-6357374 TGAAGGTGCACAGCCAGGTAAGG + Intronic
903843320 1:26260517-26260539 TCCATGTGCACAGCTAGTTTGGG + Intronic
904494927 1:30881228-30881250 GGCATGTGTACAGGCAGCTAGGG - Intronic
905603258 1:39272302-39272324 AGCCTGTGAACAGCCTGTTAGGG - Intronic
907552611 1:55317071-55317093 GGCATGTGCACACAAAGTCATGG + Intergenic
920449338 1:206047240-206047262 GATATGTGCAGAGCCAGTAAAGG + Intronic
922567127 1:226608117-226608139 GGAATGGGCACAGCCAGGTTTGG - Exonic
922825012 1:228511848-228511870 TGCATGTGCACAGCTAGGGAGGG + Intergenic
923090209 1:230735012-230735034 GGGATAAACACAGCCAGTTATGG - Intergenic
1062789260 10:291084-291106 GGCCTGTGCCCAGCCACTAAGGG + Intronic
1063647969 10:7904831-7904853 TCCATGAGCTCAGCCAGTTACGG - Intronic
1065601779 10:27376078-27376100 GGCACATGGACAGCCATTTACGG + Intergenic
1072721034 10:97781286-97781308 GGCATGGCCACAGCTAGTGAGGG + Intergenic
1073160911 10:101393781-101393803 GGCATGTGCACACCCTGCTTTGG + Intronic
1076851933 10:133097511-133097533 GGCATGCCCACAGCCAGTCATGG + Intronic
1078952342 11:16148457-16148479 GTCATGTGCACACCCAATGACGG + Intronic
1079123194 11:17699499-17699521 GGAATGAGCACAGCCACTGAGGG + Intergenic
1080429993 11:32189333-32189355 GGCATGCACACAGCCTGTTTGGG - Intergenic
1080600953 11:33820201-33820223 GGCAGGTGAACTGGCAGTTAAGG - Intergenic
1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG + Intronic
1081696314 11:45111487-45111509 GCCATGTGAACACTCAGTTAAGG + Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1083999186 11:66287024-66287046 GCCATGTGGACAGGCAGTTGTGG + Intronic
1084440954 11:69172889-69172911 GGCATGTGCACAGGCAGGGCAGG + Intergenic
1084593503 11:70104077-70104099 GGCCTGTGCTCAGCCACTTTGGG - Exonic
1085952750 11:81352300-81352322 TGCATGTGGATATCCAGTTAAGG + Intergenic
1086019355 11:82207662-82207684 GCCATGTGCACAGGCAGAAAAGG - Intergenic
1088468266 11:110165195-110165217 GGCAGGTGCAGAGCCAGGTGCGG - Exonic
1092023597 12:5222676-5222698 GGCATCTGAACAGTCAGTTAGGG + Intergenic
1092032572 12:5300254-5300276 TGCATTTGCACAGCTTGTTATGG - Intergenic
1093471698 12:19509042-19509064 GGCATGTGCCCAGGCAGACATGG + Intronic
1097032066 12:56096970-56096992 AGCATGTGCACAGCCAGCCCAGG - Intronic
1099017111 12:77357260-77357282 GGCATGTGAAAAGCCAATGAAGG - Intergenic
1101235037 12:102780213-102780235 GCCATGTGTACAGCATGTTATGG - Intergenic
1103259610 12:119575254-119575276 GGCATGTGCCCTGCCATTTTTGG + Intergenic
1105510229 13:21045641-21045663 GCCATGTGCAGAGGCAGCTATGG - Intronic
1108597358 13:51961002-51961024 GGCATCTGAACAGCCAGTTGGGG - Intronic
1109764248 13:66872401-66872423 GACATGAGCACAGCCAGATATGG - Intronic
1112108091 13:96264235-96264257 GGTATTTGCACAGCCAGTCCAGG - Intronic
1112698281 13:101975090-101975112 GGAATGTGAACAGCCAGACAGGG - Intronic
1114417048 14:22551877-22551899 GGAATGTGCACAGCCAGGGGAGG - Intergenic
1115559362 14:34569140-34569162 GGCCTGTGCACTGCCAGCCAGGG + Intronic
1122918745 14:104870962-104870984 GGCAGGTGCACAGGGAGTGAGGG - Intronic
1124407818 15:29407584-29407606 GGCCAGGGCACAGCCAGGTAAGG + Intronic
1125696064 15:41638320-41638342 GGCATGTGCCTGGCCAGATATGG + Intronic
1125925611 15:43560437-43560459 GGCCTGAGCGCAGCCAGTTCCGG + Intronic
1125938756 15:43659988-43660010 GGCCTGAGCGCAGCCAGTTCCGG + Intronic
1126192264 15:45890066-45890088 GGCGAATGAACAGCCAGTTAAGG + Intergenic
1126859824 15:52872824-52872846 GGCATGTGCATAGCAGGATAGGG + Intergenic
1134028424 16:10972412-10972434 GGCATCTGCACAGAGAGATAAGG - Intronic
1134135154 16:11672712-11672734 GGCATGGGCAGAGCCAGATGTGG - Intronic
1134371444 16:13629708-13629730 GGCATGTGCAAGACCAGCTAGGG + Intergenic
1135130714 16:19851690-19851712 GGCTGGTGCCCAGCCAGTTCCGG - Intronic
1137872516 16:51964051-51964073 GGGCTGTGCATAGCCAGTTTTGG - Intergenic
1139347944 16:66316519-66316541 GGGCCGTGCACAGGCAGTTAAGG - Intergenic
1140678124 16:77354064-77354086 GGAATGTACACAGCCAGGAAGGG + Intronic
1140811699 16:78585051-78585073 GGCCTGTTCAAAGGCAGTTACGG + Intronic
1141507493 16:84487577-84487599 GGAATGTTCCCAGCCAGTCAAGG + Intronic
1148897914 17:50850971-50850993 GGCATGTGCTCAGCCTATTTAGG - Intergenic
1152016794 17:77756186-77756208 GGGATGTGCACATTCAGTTCTGG - Intergenic
1152447406 17:80353841-80353863 GGCATCTGCACCGGCAGTTTGGG + Intronic
1152917732 17:83050853-83050875 GGCAGGTGCACGGGCAGGTATGG + Intronic
1155386033 18:25278471-25278493 GGCATGGGCACAGCTAGTGGAGG - Intronic
1155957597 18:31966878-31966900 GGTAAGTGCACACCCAGTGAAGG - Intergenic
1157555155 18:48608719-48608741 AGCCTGTGCACAGCCTGTTCTGG + Intronic
1157701586 18:49764321-49764343 GGCAGGTACTTAGCCAGTTAGGG + Intergenic
1160554668 18:79717587-79717609 GGCAGCTCCACAGCCAGTCAGGG - Exonic
1161459028 19:4385578-4385600 GGCAGCTGCACAGCCAGGGAGGG - Intronic
1165973863 19:39657489-39657511 GGCATGTGTAGGGCCTGTTAGGG - Intronic
1165981383 19:39727154-39727176 GGTATGTACAGGGCCAGTTAGGG + Intergenic
1166414057 19:42579398-42579420 TGCATGTTCACAGCCAGCAATGG - Intergenic
929028750 2:37630660-37630682 GGCATCTGCACAGAAAGTGATGG + Intergenic
929894358 2:45945590-45945612 AGCATGTGCTCAACCAGTGACGG - Intronic
930732282 2:54739646-54739668 CACATATGCACAGCCAGATATGG + Intronic
932271091 2:70411052-70411074 GGAATGTGCACACCCTGATATGG + Intergenic
934891136 2:98070291-98070313 GGCATCTCCACAGCCAGGCACGG - Intergenic
936095968 2:109530271-109530293 GGCATGTGGTCAGGCAGTCACGG + Intergenic
936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG + Intronic
938103345 2:128513040-128513062 GGCATCTTCACACCCAGTGAGGG - Intergenic
938135146 2:128750654-128750676 GGCATGTGCACAGGCAGAGGTGG - Intergenic
939772226 2:146335662-146335684 GGCATGTGCATAGTCACCTAAGG + Intergenic
941416358 2:165226338-165226360 GGCCAGTGCATAGCCAGTGAAGG + Intergenic
941826664 2:169906116-169906138 GGCCTGTGCACAGCCAATGTGGG + Exonic
943863822 2:192902214-192902236 GGCCTGTGCACAAGCATTTAAGG - Intergenic
947935243 2:233998568-233998590 TGCTTGTGCCCATCCAGTTAGGG + Intronic
947935253 2:233998623-233998645 CGCTTGTGCCCATCCAGTTAGGG + Intronic
947935259 2:233998651-233998673 CGCCTGTGCCCATCCAGTTAGGG + Intronic
947935265 2:233998679-233998701 AGCCTGTGCCCATCCAGTTAGGG + Intronic
947935277 2:233998734-233998756 AGCTTGTGCCCATCCAGTTAGGG + Intronic
948168108 2:235878645-235878667 GCCATGTGCACTCTCAGTTAAGG + Intronic
1168787300 20:551005-551027 GGATTGTGCACAGCCATGTAGGG + Intergenic
1171336923 20:24393458-24393480 GGCATGTACTCAGCCAGACAAGG - Intergenic
1173059836 20:39650826-39650848 GGCAGGGTCAGAGCCAGTTACGG - Intergenic
1174556969 20:51402779-51402801 GACATGAGCAAAGCAAGTTAGGG - Intronic
1176080449 20:63270004-63270026 GGCAAGTGCTCAGCCAGTGTAGG + Intronic
1177033916 21:16018183-16018205 GACATGTGCATAGCTAATTAAGG - Intergenic
1179200315 21:39212380-39212402 GGCATGTCCATAGACTGTTAAGG - Intronic
1181622354 22:24099742-24099764 GGCATGTGGACAACCAGGAAAGG - Intronic
1184823020 22:46925403-46925425 GGCACCTGCACAGTCAGTTCAGG - Intronic
951773186 3:26281420-26281442 GGCGAGTGCACAGGCAGGTATGG + Intergenic
952382724 3:32817430-32817452 GGCTTGCGCACAGCCAGGCACGG - Intergenic
952740374 3:36728682-36728704 AGCTTGTGGACAGCCAGTCATGG + Intronic
961771632 3:129254380-129254402 GGAGTGAGCATAGCCAGTTAGGG + Intronic
963225925 3:142861741-142861763 TGAATGTGAACAGCCAGTTGGGG - Intronic
964202984 3:154139139-154139161 GTCATGTGCACAGACATTTGGGG + Intronic
968187081 3:196640184-196640206 AGCATGTGAGCAGACAGTTAAGG + Intronic
968813704 4:2811233-2811255 GGGACCTGCACAGCCGGTTACGG + Intronic
969143129 4:5097231-5097253 AGCATGTCCACATCCATTTATGG - Intronic
969430261 4:7149832-7149854 GGCAGGTGCCCAGCCAGGTTAGG + Intergenic
969555013 4:7901627-7901649 GGCAGGTGCAGAGCCAGGGAAGG + Intronic
972850738 4:43047286-43047308 AGCATGTGCACAGCTAGGGAAGG - Intergenic
973194405 4:47423141-47423163 GACTTTTGCATAGCCAGTTAGGG - Intronic
974518589 4:62949895-62949917 GGCATGTTCCCAGACAGATATGG + Intergenic
981921501 4:150089939-150089961 GACATGTTCACAGCAAGTTAAGG - Intronic
986207275 5:5636615-5636637 GGCATTTGCTCAGTCAGTTGGGG + Intergenic
986961127 5:13214290-13214312 GGCTGGTGCACAACCAGTGAAGG + Intergenic
990672544 5:58149308-58149330 AGCATTTGCACAGCAAGTTGAGG + Intergenic
993673838 5:90794606-90794628 GGCATGTGCACAGGGTGTTAAGG + Intronic
997114437 5:131111441-131111463 GCCATGAGCACAGTCAGTTTGGG - Intergenic
997666475 5:135633454-135633476 GGCATGTGCACTGAGAGTCAGGG - Intergenic
1000546003 5:162603659-162603681 GGCATGTGCACAGTCACTCTGGG + Intergenic
1007130458 6:39467539-39467561 GGCATGTGCACAGTCACCTTAGG - Intronic
1007716778 6:43860898-43860920 GTCATGTGCACAGCAAGTAAGGG + Intergenic
1009506271 6:64484256-64484278 GGCTTGTACACAGCCAGTATTGG - Intronic
1013084690 6:106846450-106846472 GGCCTGGGAACAGCCAGCTATGG - Intergenic
1014461618 6:121703263-121703285 GGCATCTGCCCAGCCAGGCATGG - Intergenic
1015275090 6:131375942-131375964 GGCATTTGCACAGACACTGAAGG - Intergenic
1016931461 6:149414850-149414872 GGGATGTGCAAAGCCTATTAAGG - Intergenic
1020233608 7:6338984-6339006 GCCATGAGCACAGTGAGTTAAGG - Intronic
1021981053 7:26055956-26055978 AGCATCTGCACAGCCAGCAAGGG + Intergenic
1030483104 7:110129227-110129249 GGCATGTTCACAGTCATTAATGG + Intergenic
1030942032 7:115663335-115663357 GGCCTGTGCACTGGCAGTGAGGG + Intergenic
1033156858 7:138964330-138964352 GGCATGTGCACCCCCAGCCACGG - Intronic
1035052943 7:156014302-156014324 GGCATGTGCACAGTCACCTTGGG + Intergenic
1035366417 7:158351697-158351719 GGCCAGTCCACAGCCAGTCACGG + Intronic
1035700826 8:1638383-1638405 GGCATGTGCACACCCAGGAGAGG + Intronic
1036719361 8:11158705-11158727 AGCATGTGCACAGACAGGAATGG + Intronic
1039475396 8:37836957-37836979 CACCTGTGCACAGACAGTTACGG + Intronic
1040856299 8:51951965-51951987 GGCTTGAGCCCAGACAGTTAAGG + Intergenic
1045684341 8:104696088-104696110 AGAATATGCACAGCCACTTAGGG - Intronic
1047241779 8:123096635-123096657 GCCATGGACACAGTCAGTTAAGG - Intronic
1049651708 8:143772588-143772610 GGCAGGTGCACACCCAGGCAGGG + Intergenic
1050433900 9:5589215-5589237 GGAATGTGCCCAGCCAATTTGGG - Intergenic
1051552885 9:18350030-18350052 GGCCTGAGCACAGCCAGAAATGG + Intergenic
1052049562 9:23830003-23830025 GGAAGGTGCACAGCGAGTTCGGG - Intergenic
1053293518 9:36897621-36897643 GGGCTGTGCACAGCCAGGTTTGG + Intronic
1053416066 9:37947547-37947569 GGCATGGGCAGAGGCAGGTAGGG - Intronic
1053729646 9:41040225-41040247 GGCAGATGCAGAGCCAGTTAGGG + Intergenic
1054698860 9:68391837-68391859 GGCAGATGCAGAGCCAGTTAGGG - Intronic
1055231329 9:74070222-74070244 GAAATGTCCACAGCCAGGTATGG + Intergenic
1055718112 9:79141197-79141219 GGCATGTCCACAGCCTTTTATGG + Intergenic
1056733987 9:89189345-89189367 GCCAAGGTCACAGCCAGTTAAGG + Intergenic
1056757012 9:89388180-89388202 GGCATGTGCACAGCCCTCTGTGG - Intronic
1057114481 9:92507603-92507625 GCCATGTCCACAGCCTGTCATGG - Intronic
1058926131 9:109665982-109666004 GGGAGGTGCACAGCCAGGTACGG + Intronic
1059554428 9:115265049-115265071 GCCATGTGCTCAGCTAGTAATGG + Intronic
1185788498 X:2910681-2910703 GAGATGGACACAGCCAGTTAGGG - Exonic
1186592163 X:10942335-10942357 GGCATGTGAAAAGCCATATATGG + Intergenic
1191975027 X:66862187-66862209 GCCATAAGCACAGCCAGTTCAGG - Intergenic
1193270620 X:79525735-79525757 GCCATTTGCACATCCAGATATGG + Intergenic
1195677737 X:107520177-107520199 GGCATGTAGAAAGCCAGTTCTGG + Intergenic
1197098473 X:122623405-122623427 GACATGTGCGAAGCCAGTCAGGG - Intergenic