ID: 936530816

View in Genome Browser
Species Human (GRCh38)
Location 2:113276212-113276234
Sequence AAGCTGATCAGAAAGACAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936530813_936530816 20 Left 936530813 2:113276169-113276191 CCGCTTATGAGTTTAGCTCCGGT 0: 1
1: 0
2: 1
3: 1
4: 33
Right 936530816 2:113276212-113276234 AAGCTGATCAGAAAGACAGACGG 0: 1
1: 0
2: 3
3: 34
4: 428
936530814_936530816 2 Left 936530814 2:113276187-113276209 CCGGTTATAGACAACAGTGTCAG 0: 1
1: 0
2: 0
3: 11
4: 124
Right 936530816 2:113276212-113276234 AAGCTGATCAGAAAGACAGACGG 0: 1
1: 0
2: 3
3: 34
4: 428
936530811_936530816 30 Left 936530811 2:113276159-113276181 CCAGAGGGGTCCGCTTATGAGTT 0: 1
1: 0
2: 0
3: 1
4: 22
Right 936530816 2:113276212-113276234 AAGCTGATCAGAAAGACAGACGG 0: 1
1: 0
2: 3
3: 34
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936530816 Original CRISPR AAGCTGATCAGAAAGACAGA CGG Intronic
901461622 1:9395379-9395401 AGGAGGATCAGAAAGAGAGAGGG - Intergenic
901718916 1:11179516-11179538 AAGCTGGCCAAAAGGACAGAGGG - Intronic
901799439 1:11699081-11699103 CAGTTGAACAGACAGACAGATGG + Intronic
902793084 1:18782419-18782441 AAGCCCATCAGAAAGGCAGAAGG + Intergenic
903779766 1:25813861-25813883 AACCTGTTCAGGAAGACAGAAGG - Exonic
904230866 1:29070306-29070328 AAGATGAACAAAATGACAGATGG - Intronic
904592063 1:31620413-31620435 ACCCTGAGCATAAAGACAGATGG + Intronic
905008375 1:34729585-34729607 AAGCAGACAAGAAAGAAAGAGGG + Intronic
905500374 1:38431911-38431933 AAACTGATTAGAGAGACAAAAGG + Intergenic
906276629 1:44521512-44521534 AAGCTGACCTGAAAGACTGCTGG + Intronic
906655300 1:47543845-47543867 AGGCTGATTAGACAAACAGATGG - Intergenic
908152885 1:61322441-61322463 TAGCAGAGCAGTAAGACAGAAGG - Intronic
908605862 1:65796315-65796337 AAGCAGATAAGAAAGAGAGTGGG - Intronic
908772582 1:67610085-67610107 AAGCAAAACAGAAAGACGGAGGG - Intergenic
908856811 1:68439321-68439343 AAACTGTTCAGAAACACAAATGG + Exonic
908920133 1:69180279-69180301 AGGCTGCTCAAAAAGCCAGAGGG - Intergenic
910279813 1:85486985-85487007 AAAATGATCAGAACTACAGAAGG + Intronic
910984345 1:92991090-92991112 ATGGTGATAAGAGAGACAGAAGG + Intergenic
911240465 1:95459858-95459880 AAGAGGATCAGAGAGACAGAGGG + Intergenic
912096080 1:106145884-106145906 ATGGTGCTCAGAAAGACAGAAGG - Intergenic
912493065 1:110072759-110072781 GAGCTGAGCAGAGAGACACAGGG + Intronic
913584023 1:120255398-120255420 ATACTGCTAAGAAAGACAGATGG + Intergenic
913624158 1:120642943-120642965 ATACTGCTAAGAAAGACAGATGG - Intergenic
914193417 1:145430910-145430932 AAACTAATCAGAGAGAGAGAGGG + Intergenic
914566010 1:148867266-148867288 ATACTGCTAAGAAAGACAGATGG + Intronic
914606812 1:149262974-149262996 ATACTGCTAAGAAAGACAGATGG - Intergenic
915759900 1:158300541-158300563 AGGCAGATCAACAAGACAGAAGG - Intergenic
916279614 1:163035098-163035120 TGGCGGATCAGAAATACAGAAGG + Intergenic
919159841 1:193814680-193814702 AAGCAGAATAAAAAGACAGATGG - Intergenic
919252945 1:195082830-195082852 AACCTGAACCAAAAGACAGAGGG - Intergenic
919698112 1:200600454-200600476 AAGCTGCTCAGAGAAACAGTCGG - Exonic
920406649 1:205718832-205718854 AAGCAGGTCAAAAAGACGGAAGG + Intronic
920864793 1:209743083-209743105 GAGCTGAGTGGAAAGACAGAAGG - Intergenic
921628355 1:217403285-217403307 AAGCTGCTCAGAAACAGAGAAGG - Intergenic
921926806 1:220717484-220717506 ACGCTTATCAGAAATTCAGAAGG + Intergenic
922011744 1:221595814-221595836 AAGCTTCTCTGAAAGGCAGATGG - Intergenic
922064604 1:222124727-222124749 GGGCTAATCATAAAGACAGATGG - Intergenic
922321049 1:224487392-224487414 GAGAGGAACAGAAAGACAGAAGG - Intronic
922339803 1:224646233-224646255 CAGATGAAGAGAAAGACAGAGGG + Intronic
922446823 1:225704850-225704872 AAACTGAACAGAGAGAGAGAGGG + Intergenic
922819935 1:228477279-228477301 AAGTAGATGAGAGAGACAGATGG + Intergenic
923245517 1:232127624-232127646 AAGGAGAACAGAAAGAGAGATGG - Intergenic
923963985 1:239115734-239115756 AAACTTAGCTGAAAGACAGAAGG + Intergenic
924957472 1:248943719-248943741 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1063306145 10:4902815-4902837 AAGCTTATGAGAAAGTCAAAAGG + Intergenic
1063473060 10:6304383-6304405 ATGCTGTACAGAAAGATAGATGG - Intergenic
1063566433 10:7175297-7175319 AAGGTCATCAGAAAGAAAGAAGG + Intronic
1063986456 10:11509180-11509202 ATACTGCTCAGAAAGAGAGAGGG - Intronic
1064174751 10:13064897-13064919 AAGCTGATCAGAAACTCAAAAGG - Intronic
1064298014 10:14095906-14095928 AAGATGAACAGGAAGACATAAGG + Intronic
1065252498 10:23830497-23830519 AGGCAGTTCAGAGAGACAGAAGG - Intronic
1065994258 10:31041647-31041669 AAGCTGAGGAGAGAGAGAGAAGG - Intergenic
1067765083 10:49079434-49079456 AAGCTGCTCAGAAAGTGAAAAGG + Intronic
1068697726 10:59986025-59986047 AAGCAGATCTGAAAGGTAGATGG - Intergenic
1069412712 10:68169601-68169623 TGGCAGAGCAGAAAGACAGAAGG - Intronic
1069502577 10:68967222-68967244 AAGCTGATAAAAAAGACCAAAGG + Intronic
1069511398 10:69045208-69045230 AAGTTGATGAGAAAAATAGAGGG + Intergenic
1069833601 10:71295374-71295396 CAGATGAACAGAAAGACAGATGG - Intronic
1070300192 10:75198031-75198053 AAGCTGATGAGGAGGCCAGAGGG - Intergenic
1072643735 10:97234905-97234927 AAGCTGATCAGAAAACAAAAGGG + Intronic
1072822338 10:98570239-98570261 AAGCTGAGCACAGAGACAGCAGG - Intronic
1073008228 10:100340595-100340617 ATGCTGAGCAGAAAGTCAGAAGG - Intergenic
1073653699 10:105389349-105389371 AAGCTGATGAGAAATACATGAGG + Intergenic
1074188840 10:111118268-111118290 AAGCTGACCAGAAATGAAGAAGG - Intergenic
1074979706 10:118609728-118609750 TAGATGAACAGATAGACAGATGG + Intergenic
1075352910 10:121741586-121741608 ATGCTAATCACAAAGACAAATGG + Exonic
1075667204 10:124239912-124239934 AAGCAGGTCAGGAAGACACAGGG - Intergenic
1076098528 10:127754360-127754382 CAGCACATCAGAATGACAGATGG - Intergenic
1077009068 11:372117-372139 AAGCTGACCAGTGAGACCGACGG + Exonic
1077554564 11:3219651-3219673 AAGCTGCGCTGAAAGGCAGAGGG + Intergenic
1077881552 11:6354430-6354452 AAGCTGATAAGAAAGAGCTATGG + Intergenic
1078065644 11:8077569-8077591 AAGCTGATAACAAAGGAAGAGGG - Intronic
1078482863 11:11694124-11694146 AAACAGATCAACAAGACAGAAGG + Intergenic
1079816740 11:25070179-25070201 AAGTTAAGCAGAAAGACAAATGG + Intronic
1080131751 11:28803568-28803590 AGGATGATCAGAAAGATAGAAGG - Intergenic
1080850416 11:36063909-36063931 AAGCTGATCATAAATTCATATGG - Intronic
1081052622 11:38363938-38363960 AAGTAGATCAGAAAGACAACAGG + Intergenic
1081634522 11:44712051-44712073 AAGATGATCAGATTGGCAGACGG + Intergenic
1084161642 11:67353475-67353497 CAGCTGCTGAGAGAGACAGACGG + Exonic
1084466463 11:69325902-69325924 AAGAGGAGGAGAAAGACAGATGG + Intronic
1084604418 11:70164238-70164260 CAGCTGATCAGAAAATAAGAGGG + Intronic
1086191892 11:84089413-84089435 AACACGATGAGAAAGACAGAAGG - Intronic
1088025212 11:105171663-105171685 CAGCTGCTGAGAAAGAGAGAGGG + Intergenic
1088033949 11:105288985-105289007 ATCCAGATTAGAAAGACAGAAGG + Intergenic
1088306962 11:108421156-108421178 AAGCTGAGGAGAAAGATACATGG - Intronic
1089248534 11:117139873-117139895 AAACAGATCAACAAGACAGAAGG + Intergenic
1089837767 11:121386402-121386424 AAACTGAGCACAAAGACACAAGG + Intergenic
1090478232 11:127044067-127044089 AAGGAGAGCTGAAAGACAGATGG + Intergenic
1090740171 11:129652389-129652411 AAGCTGATTAAACAGACAAATGG + Intergenic
1090987696 11:131786008-131786030 AAGTTGAGGAGACAGACAGAAGG + Intronic
1091153136 11:133347900-133347922 GAGCTGAGAGGAAAGACAGAGGG + Intronic
1091327912 11:134705700-134705722 TAACTGTTCTGAAAGACAGATGG + Intergenic
1092453221 12:8622836-8622858 ACGCTGAGCAGGAAGAAAGAGGG - Intergenic
1092695646 12:11168637-11168659 AGAGTGATCAGAAAGGCAGAAGG + Intronic
1092917363 12:13200996-13201018 CAGCTGACTAGGAAGACAGAGGG + Intronic
1093515872 12:19986445-19986467 AACCTTCTCAGAAAAACAGAAGG - Intergenic
1093575365 12:20721789-20721811 TATGTGATCTGAAAGACAGAGGG - Exonic
1093598099 12:20986315-20986337 CAGCTGTTAAGAAAGACAAATGG - Intergenic
1096904314 12:54919774-54919796 AAAGAGAACAGAAAGACAGATGG - Intergenic
1097781092 12:63705819-63705841 AAGATGATAAGAAAGACCAAGGG + Intergenic
1098091775 12:66910197-66910219 AAACTGGCCAGAAAGACAGAAGG - Intergenic
1098503450 12:71221690-71221712 AAGGTGATCAAAAACAAAGAAGG - Intronic
1099314513 12:81067157-81067179 AAACAGATCAACAAGACAGAAGG + Intronic
1099351493 12:81575552-81575574 AAGGTGAACAGAAAGATATATGG + Intronic
1099649763 12:85410569-85410591 AAGCTGATGAGAGAGACTGTGGG + Intergenic
1099711470 12:86231400-86231422 CAGATGATTAGAAAGGCAGAAGG - Intronic
1100334875 12:93619496-93619518 AAGCTGAAGAGAAAGACAAAGGG + Intergenic
1100950786 12:99847277-99847299 AAGAAGCTCAGAAGGACAGAAGG - Intronic
1101124429 12:101616346-101616368 TAACTGATCTGAAAAACAGAAGG - Intronic
1101137249 12:101756965-101756987 AAGCTGTTCAGAGAGACCCAGGG - Intronic
1101346390 12:103890141-103890163 CGGCTGATCATAAAGCCAGAAGG - Intergenic
1101483713 12:105129600-105129622 CAGCTGATCAGGATGTCAGAAGG + Intronic
1102634469 12:114311044-114311066 AAGCTGAACAGCAAAACAAACGG - Intergenic
1102823768 12:115928956-115928978 GAGCTCAACAGAAAGACACAGGG + Intergenic
1102905777 12:116674221-116674243 AAGCTGGCCAGAAAACCAGAAGG - Intergenic
1103047854 12:117753079-117753101 AGGCTGATAAGAATGTCAGAGGG + Intronic
1103499368 12:121389014-121389036 AAATTGCTCAGAGAGACAGAAGG + Intronic
1104224815 12:126821052-126821074 AAGCAGAGCATAAAGAAAGATGG - Intergenic
1104339217 12:127931639-127931661 AAGCTGATGAGAATATCAGAAGG - Intergenic
1105644621 13:22303567-22303589 AAGCTAATCACCAAGACAAAGGG - Intergenic
1106298697 13:28442093-28442115 AAGTTAATCAGATAGACACAAGG + Intronic
1106696003 13:32173168-32173190 CAATTGATCTGAAAGACAGAAGG + Intronic
1109216297 13:59593204-59593226 AGACAGATCAGCAAGACAGAAGG + Intergenic
1109329414 13:60909709-60909731 AAACTAATCAGAAAGAGAAAAGG - Intergenic
1109339023 13:61030406-61030428 AAGTTATTCAGAAAGACAGAGGG - Intergenic
1109849989 13:68050259-68050281 AAGGTGAACAGAAAGCTAGATGG + Intergenic
1111467331 13:88631876-88631898 AATGTGATCACAAAAACAGATGG - Intergenic
1111907231 13:94269533-94269555 TAGCTGATTAAAAAGACAGAAGG - Intronic
1111953791 13:94733411-94733433 AAGCTGATCATAAAGCGATATGG - Intergenic
1112248174 13:97753479-97753501 ATGCTGATAAGGAAGACAGGAGG - Intergenic
1112314329 13:98347978-98348000 ATGATGAGAAGAAAGACAGAAGG - Intronic
1113828086 13:113272428-113272450 AAGCTAACCAGAAACAAAGATGG - Intergenic
1114864855 14:26577649-26577671 AAGTTCAACAGAAAGAGAGAAGG + Intronic
1114910542 14:27190221-27190243 TGGCAGAGCAGAAAGACAGAAGG + Intergenic
1115469367 14:33752814-33752836 AAAAATATCAGAAAGACAGATGG - Intronic
1116201099 14:41797723-41797745 AAGATGAACAGACAGATAGATGG - Intronic
1116424760 14:44777207-44777229 ATCCTGAACACAAAGACAGATGG + Intergenic
1117295823 14:54378147-54378169 GAGATGATCAGAGAGCCAGAAGG - Intergenic
1117729296 14:58705449-58705471 TGGCTGAGCAAAAAGACAGAAGG - Intergenic
1118118407 14:62807308-62807330 TAGCTACACAGAAAGACAGAAGG - Intronic
1118221656 14:63860000-63860022 AAGCTAGACAGACAGACAGATGG - Intronic
1118616214 14:67576062-67576084 AAGCTCAGGAGAAAGAGAGAAGG - Intronic
1119931747 14:78554217-78554239 AAGCTGCTTACAAAGAGAGAAGG + Intronic
1120584530 14:86295422-86295444 AAGCTGAGCAAGAAGACAGGAGG - Intergenic
1120708308 14:87767650-87767672 AAGCTGATGAGAAGCACTGAAGG - Intergenic
1120714356 14:87824172-87824194 AAGCTGATATGAAAGCCAGTCGG + Intergenic
1120955238 14:90076329-90076351 TGGCAGAACAGAAAGACAGAAGG - Intronic
1121472390 14:94165648-94165670 AAGCTGGTCAGAAGCACAGGTGG - Intronic
1122019320 14:98823510-98823532 AAGCTGAAGAGAAAGACTGGTGG - Intergenic
1122068437 14:99189736-99189758 AGGCTGATGACAAAGCCAGAGGG + Intronic
1124444444 15:29717113-29717135 TAGTTAATCAGAAAGACAAAGGG + Intronic
1126470112 15:49000783-49000805 ACTCTGATGAGAAAGACATATGG + Intronic
1127821589 15:62661871-62661893 AAGAAGATTATAAAGACAGAAGG + Intronic
1128040759 15:64571231-64571253 CAGCAGAGCAGAAACACAGAGGG + Intronic
1128757365 15:70192262-70192284 AAGCCTATGAGGAAGACAGATGG - Intergenic
1130167190 15:81473510-81473532 AGGCTGATCAAAATCACAGATGG + Intergenic
1131788483 15:95938505-95938527 AATCTTATTTGAAAGACAGAGGG + Intergenic
1132324004 15:100951261-100951283 AAGGACAACAGAAAGACAGATGG + Intronic
1133601042 16:7340879-7340901 AAAATGATCAAAATGACAGATGG - Intronic
1133709747 16:8389900-8389922 CAGATGAACAGACAGACAGATGG + Intergenic
1135523801 16:23198034-23198056 AAGCAGCCCAGAAAGATAGACGG - Intronic
1137007754 16:35294306-35294328 AGGCAGATGAGAGAGACAGAGGG + Intergenic
1137597864 16:49736902-49736924 ACGCTGTGCAGCAAGACAGATGG + Intronic
1137649725 16:50109660-50109682 AACCTGAAAAGAAACACAGAAGG + Intergenic
1137802497 16:51274222-51274244 AAGCTCATGAGAAAGCCAGTGGG - Intergenic
1137971361 16:52988171-52988193 AAGCAGAACTGAGAGACAGAAGG - Intergenic
1138076774 16:54050327-54050349 AATCTCATCAGCATGACAGAAGG - Intronic
1139709483 16:68764787-68764809 CAGATGAACAGACAGACAGAAGG - Intronic
1140572173 16:76120289-76120311 AAGAGGATTGGAAAGACAGAAGG + Intergenic
1140632561 16:76871638-76871660 AACCTGTTCAGCTAGACAGAAGG + Intergenic
1141756245 16:85992993-85993015 AAGAAGGACAGAAAGACAGAAGG - Intergenic
1142001597 16:87667457-87667479 GCCCTGTTCAGAAAGACAGAAGG + Intronic
1143449627 17:7028037-7028059 AAAGTGACCAGAAACACAGAAGG + Exonic
1143677440 17:8445691-8445713 AAGCTAATCAGAAACAAAGTGGG - Exonic
1143716405 17:8773974-8773996 GAGCTTATCAGAAATACAAAAGG - Intergenic
1144482536 17:15639662-15639684 CAGCTGCTCAGAAAGACTGCAGG + Intronic
1144916145 17:18725369-18725391 CAGCTGCTCAGAAAGACTGCAGG - Intronic
1146497465 17:33336000-33336022 TTGCTGAACAGAAGGACAGAGGG - Intronic
1148089820 17:45016634-45016656 AGGCTGGGCAGAAAGGCAGAGGG - Intergenic
1148696074 17:49559228-49559250 AAGGTCATCAGAAACAAAGAAGG + Intergenic
1148911100 17:50943452-50943474 AAGCTGAGCAGACACACAGCCGG + Intergenic
1149225272 17:54463455-54463477 AGACAGATCAGCAAGACAGAAGG - Intergenic
1149283721 17:55137295-55137317 GAGCAGAGCAGAAGGACAGAGGG - Intronic
1149357469 17:55856711-55856733 AAGCTGATCAAAAACAGAGAAGG - Intergenic
1150115141 17:62540936-62540958 AATCTGATGAGAAAGGTAGATGG - Intronic
1151352288 17:73538962-73538984 AAGGAGATCAGAAGGACAGCTGG - Intronic
1151874780 17:76861359-76861381 AAACTGTTCAGAAAGAAAGGGGG + Intergenic
1152745184 17:82035548-82035570 AAGCTAATGAGTAAGACAAAAGG - Intronic
1153158084 18:2171799-2171821 CAGCAGAGCAGAGAGACAGAAGG + Intergenic
1153683123 18:7519574-7519596 GAGCTGATCAGAGAACCAGAGGG + Intergenic
1153692683 18:7609194-7609216 AATCTCAGGAGAAAGACAGACGG - Intronic
1155178970 18:23326632-23326654 AAACAGATCAACAAGACAGAAGG + Intronic
1155332970 18:24736750-24736772 GAGCCGCTAAGAAAGACAGAGGG - Intergenic
1155584296 18:27347245-27347267 AAGCAGATCTGAATGACAGGAGG + Intergenic
1156430315 18:37065930-37065952 AAGCTCAACAGTAAGGCAGATGG + Intronic
1157433120 18:47646419-47646441 AAGCTCATCAGAAAGAAAAAAGG + Intergenic
1158541106 18:58355242-58355264 AAGCTTATCAGGAATAGAGAGGG + Intronic
1159066194 18:63570091-63570113 TAACTAATAAGAAAGACAGAGGG - Intergenic
1160093130 18:75845676-75845698 CAGCTGCTCAGAAAGAGAAAAGG - Intergenic
1160261897 18:77301803-77301825 AAGCAGAACAGAAAAAAAGAAGG - Intergenic
1160558905 18:79744071-79744093 AGGCTGATCAGAAACTCAGGAGG + Intronic
1160653686 19:248015-248037 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1161997078 19:7719805-7719827 GAGCTGATCATAAATGCAGATGG + Intergenic
1162327307 19:10006803-10006825 AAGAAGATCAGAAGGTCAGAGGG - Intronic
1163831563 19:19549563-19549585 GGGCTGATGAGAGAGACAGACGG - Intergenic
1163865185 19:19767633-19767655 AAGCTGAGCTGAAAGAAAAACGG + Intergenic
1164122351 19:22277753-22277775 AATATGACCAGAAAGAGAGAAGG - Intergenic
1164785700 19:30928681-30928703 CAGCTGAACAGAAGGACAGGAGG - Intergenic
1167289850 19:48618472-48618494 AAGTTGCTCAGAAAGGCAGCAGG - Intronic
1167424679 19:49423911-49423933 AAGGCTCTCAGAAAGACAGACGG + Exonic
1167739151 19:51313240-51313262 CAGGTGGTCAGAAAGTCAGAGGG - Intronic
1168103657 19:54153978-54154000 AGGCTGAGCAGACAGCCAGAGGG - Intronic
1168328420 19:55550863-55550885 AAGGTGAAAAGAAAAACAGAAGG + Intergenic
924975317 2:168436-168458 AAGCTGAACAGATATGCAGATGG + Intergenic
925881691 2:8358041-8358063 AAGCTCAGTAGAAAGTCAGAAGG + Intergenic
926232576 2:11015908-11015930 AAGCTTTGCAGAGAGACAGAAGG + Intergenic
927324301 2:21785272-21785294 AAGCTGATGAGAAGCACTGATGG - Intergenic
927400495 2:22705070-22705092 AACCTAATCAGAAAAAAAGAAGG + Intergenic
927951670 2:27174363-27174385 AAGATGGTTAGTAAGACAGAAGG - Intergenic
928248996 2:29658281-29658303 AAGCTGATCAGTGAGAGAGGAGG - Intronic
928302118 2:30134553-30134575 AAGCTGAAAAGGAAGACAAAGGG - Intergenic
928550284 2:32363594-32363616 AAGCTTATAAAAAAGACAAACGG - Intronic
930809767 2:55528260-55528282 AAGATGATCAGCAATAAAGAGGG - Intronic
931229591 2:60363173-60363195 AAGCTTATAAGGAAGAAAGATGG - Intergenic
932406402 2:71515608-71515630 ACCCTGATCTGAAAGCCAGAAGG - Exonic
933059218 2:77715397-77715419 AAACTACCCAGAAAGACAGATGG - Intergenic
933100754 2:78253732-78253754 AAGTTGAGCTGAATGACAGAAGG + Intergenic
933365016 2:81341903-81341925 AAGCAAATCATAGAGACAGAAGG + Intergenic
934154913 2:89189342-89189364 GAGCTAATCAGAATGAAAGACGG - Intergenic
934920716 2:98343059-98343081 AAGCTGACCTGAAAGAGACAGGG + Intronic
936530816 2:113276212-113276234 AAGCTGATCAGAAAGACAGACGG + Intronic
936570051 2:113605011-113605033 ATGCTGATAAGAAGGACAAAGGG - Intergenic
937914657 2:127092952-127092974 GGGCTGAGCAGACAGACAGAGGG + Intronic
938392977 2:130919442-130919464 CAGGTGATCAGAAACACAAAAGG - Intronic
938549979 2:132370965-132370987 GAGATGAACAGAAAAACAGATGG - Intergenic
938844548 2:135195357-135195379 AGGCTGATCAGAGAGAAAGGGGG - Intronic
938862098 2:135380243-135380265 AGACAGATCAGCAAGACAGAAGG + Intronic
939287132 2:140146491-140146513 AAGGTGATCATAATGACACATGG - Intergenic
939321180 2:140624863-140624885 GAGGTGATCTGAAAGACAGAAGG + Intronic
939661395 2:144895090-144895112 AAGGTGATCAGGAAGAGAGAGGG - Intergenic
939705551 2:145448110-145448132 TAGATGAATAGAAAGACAGATGG - Intergenic
939980529 2:148775563-148775585 AAGCTGGTCAGAAAGGCTGCTGG - Intronic
940817002 2:158308334-158308356 AGGCTGATAAGAAACACACAGGG - Intronic
940824517 2:158395694-158395716 GAGCTGAGCAGGAAGACAAAGGG + Intronic
941109240 2:161400220-161400242 AAGCAGAGCAGAGAGATAGAAGG - Intronic
941739104 2:169014352-169014374 AACCTGATGAGAAAAACATAAGG + Exonic
941869132 2:170365386-170365408 AATCTAATTGGAAAGACAGAAGG - Intronic
942111464 2:172686921-172686943 AAGATGATATCAAAGACAGATGG - Intergenic
943764096 2:191641853-191641875 AAACTGATCAGACAGAATGAAGG + Intergenic
945082682 2:206101823-206101845 AATCTGAGCTGACAGACAGATGG - Intergenic
945163497 2:206918248-206918270 AAGCAGATTAGAAAGACAGGAGG - Intergenic
945746327 2:213723412-213723434 AAGCAAATGAGACAGACAGAAGG - Intronic
946195035 2:218027767-218027789 GAGATGAGCAGAAAGGCAGAGGG + Intergenic
947244028 2:228027149-228027171 AAGCAAATCTGAGAGACAGAGGG + Intronic
947839323 2:233197624-233197646 AAGCAGATAAGAGAGAAAGAAGG - Intronic
1169511709 20:6271418-6271440 TCCATGATCAGAAAGACAGAGGG - Intergenic
1169789229 20:9392079-9392101 AACCTAATCAGAAAGATAAATGG - Intronic
1171003235 20:21435925-21435947 AAGCTGATAAGAAAGTCTGGGGG - Intergenic
1173073821 20:39796867-39796889 AAGCTGAATTGAAAGTCAGAAGG - Intergenic
1174158257 20:48531287-48531309 TAGCAGAGCAAAAAGACAGAGGG + Intergenic
1174340978 20:49895007-49895029 TGGCAGAGCAGAAAGACAGAAGG + Intergenic
1175135157 20:56817914-56817936 CAGTGGAACAGAAAGACAGATGG - Intergenic
1175277736 20:57783423-57783445 CAGCTGGACAGAAAGCCAGAGGG + Intergenic
1176032742 20:63021586-63021608 AAGCTCTGCAGACAGACAGACGG - Intergenic
1176277952 20:64285000-64285022 ATGCTGATAAGAAGGACAAAGGG + Intronic
1176728450 21:10465201-10465223 AAGCAGACTAGGAAGACAGAGGG - Intergenic
1177295260 21:19165450-19165472 AAGCTGCTGAAAGAGACAGATGG + Intergenic
1177657901 21:24042940-24042962 AACCTGATGTGAAAGAAAGAGGG - Intergenic
1177837058 21:26196287-26196309 AAGGTGATGAGAAAGAGTGAAGG - Intergenic
1177900984 21:26914747-26914769 AAGCAGAAGAGAAAGGCAGAAGG - Intergenic
1179105922 21:38400330-38400352 TAGCTTTTCAGAAAGACAGATGG - Intronic
1180029719 21:45198269-45198291 AGGCTGATCAAGAAGACAGAAGG + Intronic
1180263933 21:46697610-46697632 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1181786749 22:25232675-25232697 AAGCTGAGTCTAAAGACAGAAGG - Intergenic
1183483680 22:38078132-38078154 AAGCTCAGCTGAACGACAGAAGG - Exonic
1183818521 22:40324432-40324454 AACCTGATCATAAGGAAAGAGGG - Exonic
1184256229 22:43288614-43288636 GAGCTGATGAGAAAGCCAGGTGG - Intronic
1184818150 22:46888013-46888035 AAGCTGACCTGAAAGAGAGCGGG - Intronic
1185234168 22:49702057-49702079 AAGCAAATGAAAAAGACAGAGGG - Intergenic
1185430165 22:50805967-50805989 ATGCTGATAAGAAGGACAAAGGG + Intergenic
949102374 3:161606-161628 AATTTCATCAGAAAGAGAGAAGG - Intergenic
949878168 3:8640643-8640665 AAGGAGAACAGAAAGAAAGAAGG + Intronic
951581584 3:24170359-24170381 AAGCTAATGAGAAAGCCAGAAGG - Intronic
952846960 3:37695907-37695929 AGGCTGAGAGGAAAGACAGAAGG - Intronic
952874035 3:37926880-37926902 ACGATGATCATAATGACAGAAGG + Intronic
956245836 3:67181874-67181896 AGGGTGAGCAGAAAGACTGAGGG + Intergenic
956772277 3:72536796-72536818 AAGCTGAAGAGAAAGCAAGATGG + Intergenic
957015341 3:75056604-75056626 AAGAAAAACAGAAAGACAGAAGG + Intergenic
957811690 3:85229974-85229996 AAACTGATGAGAAAGACACGTGG + Intronic
959663282 3:108892966-108892988 CAGCAGATCAGAAAGACAGAAGG + Intergenic
959763760 3:109999949-109999971 AGACAGATCAGCAAGACAGAAGG - Intergenic
960082934 3:113560369-113560391 AATCTAGTCAGAAAGACAAATGG - Intronic
960286285 3:115832685-115832707 AAGCTGTTCATTAAGACGGATGG - Intronic
960973827 3:123157100-123157122 AAGCTGAAAGGAGAGACAGAGGG - Intronic
962163418 3:133023609-133023631 ATGCAGATCAGGAAGGCAGAAGG + Intergenic
962835926 3:139188425-139188447 AAGATGTTAATAAAGACAGAAGG - Intronic
963048255 3:141120472-141120494 AGACAGATCAGCAAGACAGAAGG - Intronic
963800237 3:149668951-149668973 AAGCTGACCAGAAAGTCAAAGGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
967934498 3:194716079-194716101 AAGCAGATCAGAAGCACATATGG - Intergenic
968021054 3:195389892-195389914 GAACTGATCATAAAGACAGAGGG + Intronic
968373117 4:12997-13019 ATGCTGATAAGAAGGACAAAGGG - Intergenic
968942960 4:3648680-3648702 AGGCTGATGAGAAAGACAGCGGG - Intergenic
970217683 4:13776750-13776772 ATGCTAATCAGCAAGACAGTGGG - Intergenic
971453189 4:26819178-26819200 AAGCTGCTCACAAACACAAAAGG - Intergenic
971616948 4:28803330-28803352 AAGATGATCAGAGAGACAGAGGG - Intergenic
971785735 4:31099965-31099987 ATGCTGAACAGAAGGAAAGAAGG + Intronic
972196419 4:36658607-36658629 AGGCAGATCAACAAGACAGAAGG + Intergenic
973686472 4:53375627-53375649 AAGTTATTGAGAAAGACAGAGGG - Intergenic
973875008 4:55208749-55208771 AAACAGATCAATAAGACAGAAGG + Intergenic
973970074 4:56204454-56204476 AAGCACATGAGCAAGACAGAAGG + Intronic
974563110 4:63547712-63547734 AAGCTAATAAGAAAGCCAGCCGG - Intergenic
974994323 4:69134573-69134595 AAGCTGATCATAATGAATGATGG - Intronic
976760306 4:88541522-88541544 AGACAGATCAGCAAGACAGAAGG + Intronic
976942376 4:90719175-90719197 CAGCTGATCTGAAAGGCAGGTGG - Intronic
976975640 4:91163492-91163514 AGGCAGATCAACAAGACAGAAGG - Intronic
977549523 4:98425611-98425633 CAGCAGTTCAAAAAGACAGAGGG + Intronic
977620663 4:99133387-99133409 AAGCACATCAAAAAGAAAGAGGG + Intronic
977906218 4:102480471-102480493 AGACAGATCAGCAAGACAGAAGG + Intergenic
978418159 4:108501194-108501216 AAGCAGAGCAGAGAAACAGATGG - Intergenic
978926278 4:114249542-114249564 AAGCAGATGATAAAGGCAGAAGG + Intergenic
979231782 4:118354826-118354848 AAGCTAGTCAGAAAGAAAAAGGG - Intergenic
979756497 4:124346597-124346619 AGGGTGCTCAGAAAGACAGGGGG - Intergenic
980183323 4:129429766-129429788 AAGCCTGTCAGAAAGCCAGATGG + Intergenic
980185893 4:129460845-129460867 AAGCTGAAAAGAAACACATAAGG - Intergenic
980643554 4:135611713-135611735 GAGCTTATAAGAAAGACTGAGGG - Intergenic
981438426 4:144753725-144753747 AAGATGAGCAGAAACACAAAAGG + Intergenic
982174522 4:152693168-152693190 TGGCAGAGCAGAAAGACAGAAGG - Intronic
982617983 4:157666063-157666085 AGGACTATCAGAAAGACAGAGGG - Intergenic
984128002 4:175836183-175836205 ATGGTGATTAGAAACACAGAGGG - Intronic
984890905 4:184491930-184491952 AAACTGAACAGAAGGACAGCAGG + Intergenic
985174815 4:187189492-187189514 ATGCTAATCAGAAAGAGAGATGG - Intergenic
985462275 4:190119567-190119589 ATGCTGATAAGAAGGACAAAGGG + Intergenic
985470396 5:39177-39199 AAGCTGAACAGATATGCAGATGG + Intergenic
986324865 5:6664866-6664888 GAGCTGCTGAGAAAAACAGAGGG + Intronic
986472842 5:8093231-8093253 AAGCAGATGGGAGAGACAGAGGG + Intergenic
987546259 5:19314420-19314442 AAGCTAATAAGATAGATAGATGG + Intergenic
988468415 5:31513270-31513292 AAGATGCTCAGGAAGACAGCAGG + Intronic
990866479 5:60385922-60385944 AATTTGATGAGAGAGACAGAAGG - Intronic
991406526 5:66305712-66305734 AAGCTGAACTGAGGGACAGAGGG + Intergenic
992569325 5:78038721-78038743 AAGCTGACCAGGAGGAGAGATGG + Intronic
993052302 5:82939811-82939833 GAGCAGATATGAAAGACAGAGGG - Intergenic
993083872 5:83339107-83339129 AAAATGTTCAGAAAGGCAGAAGG - Intronic
993551517 5:89279395-89279417 AACCTGACAAGAAACACAGATGG - Intergenic
993679534 5:90858958-90858980 ATTCTGATCAAAAAGACACAAGG - Intronic
994192259 5:96881664-96881686 TGGCTGAGCAGAAAGACAGAAGG - Intronic
994268440 5:97745896-97745918 AAGATGAACAGAAAGAAAAAAGG - Intergenic
995294885 5:110508279-110508301 AAGCTGTTCAGAATGATAAATGG + Intronic
995927874 5:117397149-117397171 TAGATTATCAGAAAGACACAGGG - Intergenic
996199591 5:120654902-120654924 GAGATTATCAGAAAGAGAGAGGG + Intronic
996325978 5:122274554-122274576 AGACTGATGAGAAAGAAAGATGG + Intergenic
996516701 5:124378031-124378053 AATATTATCAGAAACACAGATGG + Intergenic
996568681 5:124909005-124909027 AAGCTCATCAGAATGCCATATGG - Intergenic
996827468 5:127701816-127701838 TAGCTGATCAAAAAGAGAGGTGG - Intergenic
998895303 5:146792579-146792601 ATGCAGATCAGAAAGACTAAAGG + Intronic
999119959 5:149201521-149201543 GAGCTGAGGAGAAAGACAGTGGG + Intronic
999174508 5:149622376-149622398 AAGTTGATGACAGAGACAGAAGG + Intronic
999226381 5:150028223-150028245 ATGCTAATCAGAAACTCAGAAGG - Intronic
999362089 5:150993649-150993671 AATGTGATCAGAAAGTCAGGTGG + Intergenic
1000971907 5:167723989-167724011 CAGCTGCACAGAAAGTCAGAAGG - Intronic
1001113301 5:168916976-168916998 CAGCTGTTCAGAAGGAGAGAGGG - Intronic
1001363328 5:171110485-171110507 AAGCTCATGAGACATACAGATGG - Intronic
1001574623 5:172755104-172755126 CGGCAGAGCAGAAAGACAGAGGG - Intergenic
1001754878 5:174160536-174160558 AAGTTGTTCATAAAAACAGAAGG - Intronic
1002754945 6:149542-149564 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1003647746 6:7928264-7928286 AAACAGATCAATAAGACAGAAGG + Intronic
1004207120 6:13601932-13601954 TAGCTGATCAAAAAGACACATGG - Intronic
1004808800 6:19236215-19236237 AAAATGACCAAAAAGACAGAAGG + Intergenic
1005525051 6:26638893-26638915 AAACTGATCAGCAATACATATGG + Intronic
1007123102 6:39399968-39399990 GAGCAGATAAGGAAGACAGAGGG + Intronic
1007278132 6:40690571-40690593 AAGCTGATTAGAAATAAACATGG + Intergenic
1007286304 6:40749981-40750003 AAGGAGAGCAGAAAGAGAGAAGG - Intergenic
1007748912 6:44060013-44060035 TAGCAGGTCAGAAAGATAGAAGG + Intergenic
1008419706 6:51283999-51284021 AAACAGTTCAGAAAGAAAGAGGG + Intergenic
1010472430 6:76244543-76244565 AATTTGATCAGATAGAGAGAAGG + Intergenic
1010637162 6:78274595-78274617 AAGCTGGTCAGAAAGAATAATGG - Intergenic
1011652068 6:89515850-89515872 ATCCTTATAAGAAAGACAGAGGG + Intronic
1011884861 6:92080870-92080892 AGGCAGATCAACAAGACAGAAGG + Intergenic
1012206549 6:96467906-96467928 AAGCTCATCAGTAAGCCAGCAGG + Intergenic
1012528841 6:100210454-100210476 AAGCTAATCCGAAAGCCACATGG + Intergenic
1012779247 6:103535893-103535915 AAGAGGATCAGAAAAACAGAGGG - Intergenic
1012900359 6:104997882-104997904 AAGCTCATCAAAAAGGCACAAGG - Intronic
1013290639 6:108716354-108716376 AGGCAGAGAAGAAAGACAGACGG - Intergenic
1013451332 6:110284488-110284510 TAGATGAACAGACAGACAGATGG + Intronic
1014061175 6:117073473-117073495 AAACAGAACAGACAGACAGATGG - Intergenic
1017231829 6:152081055-152081077 AAACAGATCAACAAGACAGAAGG + Intronic
1017438605 6:154441710-154441732 AATCTGAATAGAAAGAGAGAAGG + Intronic
1017521476 6:155206814-155206836 AATGTGATGAGAAAGACAAAAGG + Intronic
1017823935 6:158068104-158068126 AAGCAGATCAGACAGAGGGACGG + Intronic
1019774590 7:2905125-2905147 TGGCAGATCAGAAAGAAAGAAGG - Intergenic
1021752048 7:23811538-23811560 AAGATGGTCAGTAAGACATAGGG - Intronic
1022939679 7:35221883-35221905 AAGATGATAAGAAAGACCAAGGG + Intronic
1022946322 7:35288354-35288376 AAACTGATCAGAAAAACAGCAGG + Intergenic
1023479269 7:40615490-40615512 ATCCTGAGCAGAAAGTCAGAAGG + Intronic
1023802335 7:43845902-43845924 CAGCTGAGTGGAAAGACAGAAGG - Intergenic
1023808330 7:43890899-43890921 TAGATGGTCAGCAAGACAGATGG - Intronic
1024960530 7:54970008-54970030 AATCTAATCAGAAAAAAAGACGG - Intergenic
1028175394 7:87650970-87650992 AAGCTTATTATAAAGACAGCTGG - Intronic
1028615857 7:92766038-92766060 AGGCAGATCAGAAAGGCAGGGGG + Intronic
1029485141 7:100835838-100835860 GAGCTGATAAGAATGAGAGAAGG + Intronic
1029789817 7:102830509-102830531 ATGCTGACCAGAAAGACATCTGG + Intronic
1029866301 7:103634223-103634245 GAGGAGATGAGAAAGACAGAAGG - Intronic
1030180432 7:106702386-106702408 AAGGTTATCAGAAACAAAGAGGG - Intergenic
1030621110 7:111792277-111792299 AGGCTGAGCAGAAAGATAGCTGG + Intronic
1030865267 7:114694866-114694888 AAGCAGAGAAGAAATACAGATGG + Intergenic
1031350978 7:120730768-120730790 AAACTGTTGAGAGAGACAGAAGG - Intronic
1032649248 7:133859232-133859254 AAGCTTATCAGAGAGCCAGGTGG - Intronic
1034131281 7:148720433-148720455 AAGCTGATGGGAAATGCAGAAGG + Intronic
1034674424 7:152882352-152882374 AAACCCATCAGAAAGGCAGAGGG - Intergenic
1035513216 8:207810-207832 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1037138392 8:15491017-15491039 ACGCTGATCAGAAACTCAAAAGG - Intronic
1039010707 8:33089920-33089942 AAGCTAGCCAGAACGACAGAAGG + Intergenic
1039632820 8:39131719-39131741 AATATTATCAGAAAGAAAGAAGG - Intronic
1039937218 8:42055873-42055895 AAGATGATAGGAAATACAGATGG - Intergenic
1041132051 8:54711500-54711522 AACCAGATCAGCAAGACAAAGGG + Intergenic
1041748797 8:61237082-61237104 AGGATGATCAGTAAGACAAAGGG + Intronic
1042289184 8:67150136-67150158 AAGCTGAGAAGAAACACAGTAGG - Intronic
1043712406 8:83438935-83438957 AATATTATCAGAAAGACAGAAGG - Intergenic
1043859682 8:85301583-85301605 AAGAAGATCAGAAAGACCAATGG - Intergenic
1044576712 8:93777914-93777936 AGGCAGATCAACAAGACAGAAGG - Intronic
1044867038 8:96581714-96581736 AGGTAGATTAGAAAGACAGAAGG + Intronic
1044932260 8:97261349-97261371 AGGCACATCAGAAATACAGAGGG + Intergenic
1045497452 8:102720355-102720377 AAGCCCATCAGCAAAACAGATGG - Intergenic
1046808422 8:118505605-118505627 AGGCAGAGGAGAAAGACAGAAGG + Intronic
1047042737 8:121015575-121015597 AATCAGATAAGATAGACAGATGG - Intergenic
1047994425 8:130320253-130320275 AAGATCATAAGAAATACAGAGGG + Intronic
1048038275 8:130699018-130699040 AGACTCATCAGAAGGACAGATGG + Intergenic
1048190781 8:132286395-132286417 AAGCAAATCTGAAACACAGAGGG - Intronic
1048376805 8:133829863-133829885 AAGCTGATAGAAAATACAGAGGG - Intergenic
1049497808 8:142944810-142944832 AGGCTGCTCAGAAAGGAAGAAGG - Intergenic
1050910166 9:11057666-11057688 CTGCTGATAAGAGAGACAGAGGG - Intergenic
1051203771 9:14662783-14662805 AAACTCATCCGAAAAACAGATGG + Intronic
1051581410 9:18680140-18680162 AACCTGATGAGTAAGAGAGAAGG - Intronic
1051692309 9:19728229-19728251 AAGGTTTTCAGAAAGGCAGATGG + Intronic
1052981563 9:34453854-34453876 AAGCTGAGCAGACAGACAATAGG + Intronic
1053360732 9:37485186-37485208 AAGGTGATTTGGAAGACAGAGGG + Intergenic
1053485767 9:38454996-38455018 AAAATGATAAGAAAGAAAGAAGG - Intergenic
1055282021 9:74685331-74685353 AAGATGTTCAGAAAGAAAGAAGG - Intronic
1055389669 9:75806761-75806783 AAGCAGAGAAGAAAAACAGAGGG - Intergenic
1057282410 9:93722375-93722397 AGGCTGAGCAGAAAGACAGAAGG - Intergenic
1057768846 9:97948910-97948932 AAACAGATCAACAAGACAGAAGG - Intergenic
1058068145 9:100572337-100572359 AGGCATATCAGAAAGACAGTAGG + Intronic
1058594110 9:106596761-106596783 AAAATGATCAAGAAGACAGAGGG + Intergenic
1059152584 9:111962816-111962838 TACCTGATGAGAAAGACAGAAGG + Intergenic
1059676991 9:116549208-116549230 AAGCTGAAAATAAAGAAAGAAGG + Intronic
1059758592 9:117317287-117317309 GAGCTGATGAGAAACACGGAAGG - Intronic
1060245528 9:121942832-121942854 AAGCTCATCAGACAGAGAAAGGG - Intronic
1061836867 9:133335340-133335362 AAAAGGATGAGAAAGACAGACGG + Intronic
1185681066 X:1888612-1888634 AAGCTGGATATAAAGACAGAAGG - Intergenic
1187269848 X:17769795-17769817 ATGAGGCTCAGAAAGACAGAAGG - Intergenic
1187478846 X:19636762-19636784 AAGCTGAACATATACACAGAAGG + Intronic
1188206295 X:27363342-27363364 AAGCTTATCATCAAGTCAGAAGG + Intergenic
1189256532 X:39644393-39644415 AAGCTGAGCAAATAGAAAGAGGG + Intergenic
1189559484 X:42177413-42177435 AAGCAGATCAGGAAGACGGAAGG - Intergenic
1189922888 X:45920690-45920712 AAGCTTATCAGAAACAAAAAGGG - Intergenic
1190491669 X:50988870-50988892 CAGCTGATGAGCAAAACAGAAGG + Intergenic
1191096717 X:56680873-56680895 AAGCTGAGGAGCAAGAAAGACGG + Intergenic
1192234201 X:69285718-69285740 AAGCTGATAAGGAAGAAAGGAGG + Intergenic
1192580851 X:72279774-72279796 AAGCCGATCAGAAAGAGAACAGG - Intronic
1193045144 X:77045918-77045940 AAACAAATCAGAAAGAAAGAAGG + Intergenic
1194726194 X:97400350-97400372 AAGCTGGTTAGAAAGATATACGG + Intronic
1197799588 X:130335578-130335600 AAGCTGATAGGAAAGATAAATGG + Intergenic
1200248282 X:154537831-154537853 AACCTGATGAGAAAGGCACATGG + Intronic
1201344431 Y:12967221-12967243 GTGATGATCAGAAAGTCAGATGG + Intergenic
1201480361 Y:14432318-14432340 CTGCAGATCAGAATGACAGAGGG + Intergenic
1201561259 Y:15319861-15319883 AGACAGATCAAAAAGACAGAAGG - Intergenic