ID: 936531642

View in Genome Browser
Species Human (GRCh38)
Location 2:113280106-113280128
Sequence GAGGGGGGCAAGGAAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 1, 2: 2, 3: 68, 4: 775}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936531629_936531642 20 Left 936531629 2:113280063-113280085 CCTGGTGGGGTTGTTCTGGGACA 0: 1
1: 0
2: 0
3: 7
4: 154
Right 936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG 0: 1
1: 1
2: 2
3: 68
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936531642 Original CRISPR GAGGGGGGCAAGGAAGGTGC AGG Intergenic
900141533 1:1141152-1141174 GATGGGGGCAGGGATGGGGCTGG - Intergenic
900198799 1:1393008-1393030 GAGAGGGGCAGAGAAGGTTCTGG - Intronic
900317826 1:2068270-2068292 GGGGGTGGCAAGGAAGGCGGGGG - Intronic
900347140 1:2215242-2215264 GAGGGGGCCAAGGGTGGTGCCGG + Intergenic
900618550 1:3576557-3576579 GAGGAGGGACAGGAAGGTGATGG + Intronic
900647231 1:3714458-3714480 GGTGGGGGCAAGGATGGTGGGGG + Intronic
900868519 1:5285633-5285655 GAGGGAGGCATGGAAGGGTCGGG + Intergenic
901297483 1:8171448-8171470 GAAGAGGGCAAGAAAGCTGCAGG + Intergenic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902206720 1:14873718-14873740 TAGGGAGGAAAGGCAGGTGCCGG + Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
902686207 1:18079301-18079323 GAGAGGGGGAAGGAAGGGGAGGG + Intergenic
902754224 1:18538524-18538546 GAAGGTGACAAGGAAGGTGAAGG - Intergenic
902896939 1:19485575-19485597 GGGGCGGGGAAGGAAGGTGGCGG - Intergenic
902987411 1:20163481-20163503 CAGAGGGGCAAGGAAAGTGGTGG + Intronic
903149666 1:21397871-21397893 GAGGGGTGAAAAGAAGGTGGAGG + Intergenic
903282386 1:22257399-22257421 GAGGGGGAGGAGGAAGGGGCAGG - Intergenic
903353540 1:22732319-22732341 GAGGGGGCCAGAGAAGGTGGGGG + Intronic
903475786 1:23618460-23618482 GAGAGGGGCAAGGCACGTGCTGG - Intronic
904471629 1:30740034-30740056 GAGGAGGGCAGGGAAGGTTTGGG - Intronic
904599518 1:31665834-31665856 CAGGGAGGCAGGGAAGGAGCTGG - Intronic
904830532 1:33303703-33303725 GAGGGGTTCCAGGAAGCTGCAGG - Intergenic
905303175 1:36999278-36999300 GAGGTGGGAGAGGAAGCTGCAGG + Intronic
905617930 1:39413917-39413939 GAGGTGGGCACTGAAGCTGCCGG - Exonic
906720557 1:48001238-48001260 GAGGGTGGGTAGGAAGGAGCAGG - Intergenic
906747177 1:48230285-48230307 GAGGAAGTGAAGGAAGGTGCTGG - Intronic
906787462 1:48628594-48628616 GAGGAGGGCATGTGAGGTGCAGG - Intronic
908006303 1:59732653-59732675 AAGGGGGGCAAGAAAGGGGAAGG + Intronic
908179549 1:61590234-61590256 GCTGGGGTCAAGGCAGGTGCAGG + Intergenic
908892181 1:68860401-68860423 GAGAGGGGCCAGGAAAGTGCTGG - Intergenic
909480073 1:76121304-76121326 GAGGGTGGCAGGTAAGGTGGTGG - Intronic
910846796 1:91611921-91611943 GATGGGGGCAAGGAGGGAGGAGG + Intergenic
911420508 1:97635244-97635266 AATGGGAGGAAGGAAGGTGCGGG - Intronic
911660925 1:100500349-100500371 GAGGGGAGGAGGAAAGGTGCTGG + Intronic
912528074 1:110299571-110299593 GATGGGGGCCAGGAAGGAGGGGG + Intergenic
913363361 1:118007206-118007228 TTATGGGGCAAGGAAGGTGCTGG - Intronic
913414630 1:118591281-118591303 GAGGGGAGCAAGGAAGATAGGGG + Intergenic
914340393 1:146755225-146755247 GAGGGGGACAAGGGAGATGGAGG - Intergenic
914428703 1:147600464-147600486 GAGGGGGGCAGAAAAGGGGCGGG + Intronic
914676320 1:149909734-149909756 GAGAGGGGCCAGGTAGGGGCTGG + Intronic
915321153 1:155057160-155057182 GAGGGTGGCAAGGAAGGTTGGGG - Intronic
915341329 1:155178465-155178487 GATGGGGGCAAGAAAGGGTCAGG - Intronic
915498065 1:156295090-156295112 GAGGGGGGCTTGGAAAGTGCTGG + Intronic
915826770 1:159086430-159086452 GAGGGAGGCCAGGAAGGGCCTGG - Intronic
915913402 1:159928063-159928085 GAGTGGAGCAGAGAAGGTGCAGG + Intronic
916922710 1:169485794-169485816 GAGGAGGAGAAGGAAGGGGCCGG - Exonic
917157354 1:172018957-172018979 GAGGGAGGGAAGGAAGGGGAAGG - Intronic
917754776 1:178088178-178088200 GCAAGGGGCAAGGAAAGTGCTGG + Intergenic
917977665 1:180250766-180250788 GAGGGTGGAGAGGAAGGTGATGG + Intronic
919986690 1:202680681-202680703 GAGAGGGGCAAGGAAGAAGCTGG - Intronic
920035115 1:203060515-203060537 GAGGATGGGAAGGAAGGGGCAGG - Intronic
920067874 1:203282022-203282044 GAGAGGGGCAAGGAGGGTCCAGG - Intergenic
920111880 1:203592608-203592630 GTGGGGGGCAGGGAAGTTGGGGG + Intergenic
920182936 1:204143619-204143641 CAGGAGGGGAAGGAAGGGGCTGG + Intronic
920366414 1:205450435-205450457 GAGGGGGGCCAGGCAGGAGAGGG - Intronic
920501961 1:206491169-206491191 GGGGGAGGCAGGGAAGGTTCAGG - Exonic
920563164 1:206953525-206953547 GAGGTAGGGAAGGAAAGTGCTGG + Intergenic
921190559 1:212704404-212704426 GAGAGGGGCAAGGAAGAAACAGG + Intergenic
921217624 1:212950959-212950981 GAGGGGAGCCACGAACGTGCTGG - Intronic
921557141 1:216612357-216612379 GAGGGAAGGAAGGAAGGGGCGGG + Intronic
924030404 1:239880148-239880170 GAAGGGGGTAAGGAAAGTGTGGG + Intronic
924414806 1:243849189-243849211 GAGGTGGACAAGGAAGAGGCTGG + Intronic
924697952 1:246419599-246419621 GAAGGGGGTAAGGGAAGTGCTGG - Intronic
1062860302 10:805189-805211 GTGGGGGGCCTGGAGGGTGCAGG + Intergenic
1062876449 10:946761-946783 GAGGGTGGCAAGGAAGAGGAGGG - Intergenic
1062904598 10:1171141-1171163 GAGGCTGGCACGGAAGGGGCTGG + Intergenic
1062916363 10:1243696-1243718 CATGGGGGCAAGGATGCTGCTGG - Intronic
1062923518 10:1297612-1297634 GAGGAGGGCAAGGGAGCTGCTGG - Intronic
1063369704 10:5513107-5513129 GTGGGGGCAAAGGAAGGTGAGGG - Intergenic
1064131840 10:12716609-12716631 AAATGGGGCAAAGAAGGTGCAGG - Intronic
1065169187 10:23010439-23010461 GAGGAGGGAAAGGAAGGAGAGGG - Intronic
1066406823 10:35126809-35126831 GAGGGGCGGCGGGAAGGTGCGGG - Intronic
1066496874 10:35950492-35950514 GAGGGGGGCAGGGAGGGAGGGGG + Intergenic
1067463262 10:46474105-46474127 GTGGGAGGCAGGGAAGGTGTTGG - Intergenic
1067623932 10:47910533-47910555 GTGGGAGGCAGGGAAGGTGTTGG + Intergenic
1067734042 10:48835269-48835291 GAGGGGGGCGAGAGAGGGGCTGG + Intronic
1069076026 10:64039306-64039328 GAGGAGGGCCAGCAAGGTGCAGG - Intergenic
1069688430 10:70334265-70334287 GAGGGGGCTCAGGAATGTGCAGG - Intronic
1069822481 10:71236316-71236338 GCTGGGGGCAGGGAAGGTGTAGG - Intronic
1069903703 10:71720151-71720173 GAGGGGAGCAGGGAGAGTGCTGG + Intronic
1070835363 10:79444473-79444495 GAGGGGGGCTAGAAAGGGGGGGG - Intronic
1071489878 10:86129002-86129024 AAGCGGGGCAAGAAAGGGGCTGG + Intronic
1071518448 10:86314526-86314548 GAGATGGGCAAGGAAGCTTCAGG + Intronic
1071544850 10:86521546-86521568 GAGGCGGGGAGGGAAGTTGCGGG - Exonic
1071554891 10:86594363-86594385 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
1071761104 10:88608331-88608353 GAGGGAGGCTATGAATGTGCAGG + Intergenic
1071766546 10:88672356-88672378 GAGGAGGGAAAGGAAGGGGAGGG + Intronic
1072059517 10:91796479-91796501 GAGGTGAGCAGAGAAGGTGCAGG - Intergenic
1072165871 10:92812677-92812699 GAGGTGGGCAAGGAAGTTGAAGG - Intergenic
1072309375 10:94139682-94139704 AAGGGGGGCAAGGCAGCTCCTGG - Intronic
1072868017 10:99085079-99085101 GAGGAGTGCAAGCCAGGTGCAGG + Intronic
1072894376 10:99353562-99353584 GAAGGGAGTAAGGGAGGTGCAGG + Intronic
1073137219 10:101226760-101226782 GAGGGAGGCGAGGAAGGAGCGGG + Exonic
1073393627 10:103200126-103200148 GAGAAGGGAAAGGAAGGTACAGG - Intergenic
1074202287 10:111248644-111248666 GAAGGGGGTCAGGAAGGGGCAGG - Intergenic
1074349176 10:112717960-112717982 GAAGGGAGCAAGGAAGGTTGTGG - Intronic
1075077370 10:119360146-119360168 GAGGGGGTGAAGGAAGTTGAGGG + Intronic
1075153186 10:119953539-119953561 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1075153206 10:119953602-119953624 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1075791565 10:125087984-125088006 GAGGTGGGAATGGACGGTGCAGG - Intronic
1076019417 10:127059458-127059480 GAAGAGGGCTAGGAATGTGCAGG - Intronic
1076426070 10:130368459-130368481 GAGGGGGCCAGGGGAGGTTCTGG + Intergenic
1076661808 10:132060300-132060322 GATGGGGGCCAGGCAGGTTCTGG + Intergenic
1076662501 10:132064935-132064957 GTGGGGGGCAGGCAGGGTGCAGG + Intergenic
1076736743 10:132462406-132462428 CAGGAGGGAAAGGGAGGTGCTGG + Intergenic
1076982675 11:213193-213215 GAGGTGGGCAAGGCAACTGCAGG - Intronic
1076999503 11:315696-315718 CAGGGGAGCAGGGAAGATGCCGG - Intergenic
1077036186 11:495610-495632 GTGGGGGCCAGGGAAGCTGCAGG + Intronic
1077272214 11:1686717-1686739 GAGGGAGGCAGGGAAGGAGGGGG - Intergenic
1077369754 11:2175979-2176001 GTGGTGGGCAAGGCTGGTGCTGG - Intergenic
1077394674 11:2315173-2315195 GAGGGGAGCAGGGAGGGGGCAGG - Intronic
1078093320 11:8281285-8281307 GAGAAGGGCAAGAAAGGGGCTGG - Intergenic
1078597273 11:12698271-12698293 GAGCGCAGCAAGGAAGGAGCAGG - Intronic
1078603639 11:12755889-12755911 GACGGGAGAAAGGAAGGGGCAGG + Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079358320 11:19748739-19748761 GAACGGGGCAGGGAAGGTGCAGG + Intronic
1080685209 11:34509614-34509636 GAGGGGGGCAGGGAGGGGGTAGG + Intronic
1081268953 11:41060976-41060998 GAGGGGGGAGGGGAAGGGGCGGG - Intronic
1081691198 11:45079891-45079913 GAGGGGGGCAGGGAAGACACAGG - Intergenic
1081733644 11:45388813-45388835 GAGGTGGGCAAGGCAGGAGCTGG + Intergenic
1083074773 11:60024715-60024737 GATGGGGGCAAAGAAGTTGAAGG + Intergenic
1083266935 11:61551120-61551142 GAGGTGGGCGCAGAAGGTGCTGG + Intronic
1083597126 11:63923309-63923331 GAGTGGGGTACGGGAGGTGCAGG - Intergenic
1083680254 11:64348414-64348436 GAGGAGGGCAGGGCAGGGGCTGG + Intronic
1083990419 11:66243054-66243076 GAGGAGGGCAAGAAAGGGACTGG + Intronic
1084319441 11:68365310-68365332 GAGGGTGGCCAGGAAGGTCACGG + Intronic
1084357687 11:68650943-68650965 GAGGGGGACAGGGAAGGAGCAGG - Intergenic
1084464281 11:69313161-69313183 GAGGGGGCCAAGGGAGGCGCTGG + Intronic
1084495303 11:69500009-69500031 GAGGTTGGCCAGGAAGGGGCAGG - Intergenic
1084595622 11:70115229-70115251 GAAGGGGTCATGGAAGTTGCTGG + Intronic
1084942154 11:72618575-72618597 AAGGGGGGCAAAGAAGGTCTGGG - Intronic
1085286791 11:75367817-75367839 GAGGGGGGCGTGGAGGGGGCAGG + Intergenic
1085426394 11:76408601-76408623 GAGCAGGGCCAGGAAGGTGCTGG + Intronic
1085764070 11:79267310-79267332 CAGTGGGGCAGGGCAGGTGCAGG - Intronic
1087010409 11:93508837-93508859 GAGGTGGGAAAAGAAGGAGCAGG + Intronic
1087788869 11:102385670-102385692 GAAGGGGGCCAGGGAAGTGCTGG - Intergenic
1087969403 11:104461003-104461025 GAGTGGGGCAATGATGGTCCTGG - Intergenic
1088394124 11:109348049-109348071 GAGGGAGGGAAGGAAGGAGAGGG - Intergenic
1088832801 11:113551868-113551890 GAGGTGGAGAAGGAGGGTGCAGG - Intergenic
1089120697 11:116132624-116132646 GAGGAGTGGATGGAAGGTGCCGG - Intergenic
1089362584 11:117900891-117900913 GACGGGCCCAAGGAAGGTGAGGG + Intronic
1090357063 11:126147217-126147239 GAGGGAGGAAAGGAAGGGGAGGG - Intergenic
1090397571 11:126429363-126429385 GAGGGTGGCAGGGCAGGGGCAGG - Intronic
1091392082 12:131766-131788 GAGGGTGGGGAGGAAGGTGTAGG + Intronic
1091770379 12:3147491-3147513 GAAGTGGGCAGGGAAGGTGGGGG - Intronic
1091793864 12:3286365-3286387 CAGGTGGGCAAGGAGGGGGCAGG - Exonic
1092145792 12:6213826-6213848 GAGGGAGGGAGGGAAGATGCTGG - Intronic
1092334285 12:7614978-7615000 GAGGGAGGGAAGGAAGGAGAAGG + Intergenic
1092869257 12:12791754-12791776 GAGGTGGGCAGGGAGGGTGAAGG + Intronic
1092981553 12:13799699-13799721 GAGGGGGGGAAAGGAGGAGCAGG + Intronic
1093118987 12:15244968-15244990 GAGGGGAGCAAAGAAGGAGAGGG + Intronic
1094294571 12:28889864-28889886 GCAGGGGGCAGGGGAGGTGCTGG - Intergenic
1094533928 12:31304424-31304446 GTGGGAGGCCAGGAATGTGCAGG + Intronic
1094724628 12:33101196-33101218 GAGAGGGGCAGGGAAAGTGAAGG + Intergenic
1095752743 12:45729467-45729489 GAGGGAGGGAAGGAAGGGGTGGG + Intergenic
1095752773 12:45729612-45729634 GAGGAGGGGAAGGAGGGAGCAGG - Intergenic
1096253745 12:50050779-50050801 GAGGGGGCGAGGGGAGGTGCTGG - Intergenic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1097173096 12:57128416-57128438 GAGGGAGGGAGGGAAGGGGCGGG - Intronic
1097641957 12:62192388-62192410 GAGGGGAGAAAGAAAGGAGCGGG + Exonic
1098216384 12:68224666-68224688 GAGGGAGGGAAGGAGGGTGGAGG + Intronic
1098450929 12:70617497-70617519 GAGGAGGGCAAAGAAGTAGCGGG - Intronic
1099984415 12:89646471-89646493 GAGGGAGGCAAGGAAGGCAGGGG + Intronic
1100962932 12:99984255-99984277 GAGGGGGGCAAGGACTCTGTGGG - Intronic
1101023990 12:100582876-100582898 GAGGGAGCCAAGGAATATGCAGG - Intronic
1101431773 12:104632919-104632941 GAGGGGGTGAGGGAAGGTGTTGG + Intronic
1101633114 12:106514793-106514815 GATGGGCGGAAGGAAGGTGGTGG + Intronic
1101858372 12:108462961-108462983 GAGGAGGGGAAGGAAGGGGAGGG + Intergenic
1102558032 12:113741820-113741842 GAGGGGGGGAAGGAGGGAGGAGG + Intergenic
1102565374 12:113794158-113794180 GATGGGGCAAAGGAAGGTTCAGG - Intergenic
1102845905 12:116182130-116182152 GAGAGGGTCAAGGAAGGTGGGGG - Intronic
1102902138 12:116647113-116647135 GAAGGGGGAAAGGAAGGGGAGGG - Intergenic
1103480450 12:121247077-121247099 AAGCAGGGCAAGGAAGGTGGAGG - Intronic
1103509985 12:121467433-121467455 GAGGCGAGCCAGGAAGGGGCTGG + Intronic
1103931316 12:124452600-124452622 GAAGGGGGCCAGAAAGGGGCTGG + Intronic
1103995798 12:124829271-124829293 GATGGGGGCCAGGATGGTGTTGG - Intronic
1104006776 12:124898551-124898573 GAGGGGTGCAGGGACGGTGTGGG + Intergenic
1104506754 12:129339330-129339352 GAGGAGGGGAAGGAGGGGGCCGG + Intronic
1104604105 12:130175461-130175483 GAGGAGGGAAAGGAAGGGGAGGG + Intergenic
1104925483 12:132311869-132311891 GAGAGGGGCAAGGGAGCTGGTGG - Intronic
1104978159 12:132561304-132561326 GAGGGCTGCAAGGAAGGGGAGGG - Intronic
1105594882 13:21827979-21828001 GAAGGGGGGAAGGGAAGTGCTGG + Intergenic
1105618213 13:22040796-22040818 GAGGGGGGGAAGGGAAGTGCTGG + Intergenic
1105819450 13:24066688-24066710 GAGGAGGGGAATGAAGGTGGGGG - Intronic
1106004130 13:25752898-25752920 GAGGGTGGCAAGGAAAGGGAAGG - Intronic
1106182887 13:27383502-27383524 GAAGGGGGTAAGGGAAGTGCAGG + Intergenic
1106194202 13:27479640-27479662 GAGGGAGGGAAGGAATGTCCTGG + Intergenic
1106308843 13:28535330-28535352 GAGGGGGCCAAGGAAGCAGGGGG - Intergenic
1107917643 13:45168904-45168926 GAGGGAGGGAAGGAAGGAGGAGG - Intronic
1108546840 13:51503525-51503547 GAGGGGGGGAGGGAGGGTGGGGG - Intergenic
1110818192 13:79884092-79884114 GTGAGGGGCAAGGAAGGAGATGG + Intergenic
1111672501 13:91348162-91348184 GAGGGGGGCAGGGCCGGGGCGGG + Intergenic
1113016500 13:105834141-105834163 CACTGGGGCAAGGAAGGGGCTGG - Intergenic
1114258669 14:21022704-21022726 GAGGAGGGGAAGGAAGGAGAGGG + Intronic
1114530056 14:23389815-23389837 GAGGGGGACACAGAAGGTGTGGG + Intronic
1114532128 14:23402840-23402862 GCGGAGGGCAGGGAAGGGGCAGG + Intronic
1115028502 14:28767760-28767782 GAGGGCGGCAAGGACGGGGAGGG + Exonic
1115478234 14:33836625-33836647 GCGAGGGGCAGGGAAGGGGCAGG - Intergenic
1115664770 14:35534538-35534560 GCGGGTGGCAGGGAAGGTCCCGG + Exonic
1117119574 14:52553101-52553123 GAGCGCGGGAAGGAAGGGGCTGG - Intergenic
1117136165 14:52736159-52736181 GGTGAGGGTAAGGAAGGTGCTGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117342848 14:54806632-54806654 AAGGGGCGCAGGGAAGGTGCGGG - Intergenic
1118121599 14:62850751-62850773 CAGAGGGGCAGGGAAGTTGCGGG - Intronic
1118136944 14:63039878-63039900 GGGGGTGGCAAGCAAGGTGGGGG + Intronic
1118430191 14:65710931-65710953 GAGAGGGGTGAGGAAGATGCTGG + Intronic
1118767396 14:68919068-68919090 GAGGAGGGCAGGGAAGGGGAAGG - Intronic
1118780520 14:69004820-69004842 GAGGAGGGAAAGGAAGGGGAGGG - Intergenic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119456881 14:74763723-74763745 GAGGGGGCGGAGGAAGGTGGTGG - Exonic
1119658758 14:76436030-76436052 GAGGGAAGCAAAGAAGATGCTGG - Intronic
1120711263 14:87795769-87795791 GTGGGGGGAAAGGAAGGGGAGGG - Intergenic
1121007941 14:90502186-90502208 GAGGGGAGGAAGGAATGTTCAGG - Intergenic
1121302830 14:92885572-92885594 GTGGGAGGGAAGGAAGGTGAGGG + Intergenic
1121324558 14:93012436-93012458 GAGGGGGCCAGGGAAGGAGCGGG + Intronic
1121780885 14:96621878-96621900 GAGGGGAGGAATCAAGGTGCTGG - Intergenic
1122096479 14:99376543-99376565 GAGGGAGGGAAGGAAGGGGAGGG + Intergenic
1122329718 14:100904228-100904250 GGGGGGGGCCAGGAGGGTGGTGG - Intergenic
1122353393 14:101110281-101110303 GAGGAGGCCAGGGAAGGTGCTGG + Intergenic
1122357870 14:101134888-101134910 GAATGGGGAAAGGAAGGGGCTGG + Intergenic
1122392500 14:101399829-101399851 GAGGGAGGGAAGGAAGGGGAAGG + Intergenic
1122607252 14:102955024-102955046 GACCGGGGCAAGGAGGCTGCAGG - Intronic
1122823210 14:104357358-104357380 CAGGGGAGCAAGGCAGATGCTGG + Intergenic
1122971917 14:105155731-105155753 AAGGAGTGCAAGGAAGGTGAGGG - Exonic
1123082282 14:105701205-105701227 GAGTGGGGACAGGAAGGTGAGGG - Intergenic
1123121579 14:105919302-105919324 CAGGGGGTCATGGAAGGGGCTGG - Intronic
1202930911 14_KI270725v1_random:31356-31378 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1123404294 15:20010963-20010985 CAGGGGGTCATGGAAGGGGCTGG - Intergenic
1123513629 15:21017610-21017632 CAGGGGGTCATGGAAGGGGCTGG - Intergenic
1124042393 15:26117541-26117563 GATGAGGGCAACTAAGGTGCAGG + Intergenic
1124047560 15:26164141-26164163 GTGGGTGGCAAGGAAGGTGGTGG + Intergenic
1124427121 15:29571141-29571163 GAGAGGGGCGGGGAAGGCGCAGG + Intergenic
1124785049 15:32671857-32671879 GAGTGGGGCGAGGAAGGGGCGGG - Intronic
1125104819 15:35958187-35958209 GAGGGGGAGAAGCAAGGGGCAGG - Intergenic
1125894557 15:43291803-43291825 GAGAGGGGCAAGGAAGGAAGGGG - Intronic
1126734607 15:51718268-51718290 GTGGGGGGCAATTAAGGTGATGG + Intronic
1126837341 15:52679797-52679819 GAGGGGGGGAAGGAGGGGGAGGG - Intronic
1126901456 15:53318860-53318882 GGGGGGACCAAGGAAGCTGCCGG + Intergenic
1128046140 15:64619017-64619039 GAAGGGGGTAAGGGAAGTGCTGG - Intronic
1128372457 15:67050272-67050294 GAGTGGGGCAAGGAAGGGAGGGG + Intergenic
1128482732 15:68054213-68054235 GAGGCGGGCTGGGAAGGTGGAGG + Exonic
1128515752 15:68340857-68340879 GACGGGCCCAAGGAAGGTGGTGG + Intronic
1128569769 15:68725804-68725826 GAGGGGGCCAAGGAGGGCCCAGG - Intronic
1128609832 15:69064813-69064835 GAGGGGTGCATGCAAGGTGGGGG - Intergenic
1128612416 15:69084667-69084689 GAGGGAGGGAAGGAAGGAACGGG - Intergenic
1128818862 15:70634343-70634365 GAGGGGGGCTGGGGAGGCGCTGG + Intergenic
1129030222 15:72612341-72612363 GAAGGTGGCAAAGGAGGTGCAGG - Intergenic
1129145892 15:73646829-73646851 GAGGGGGGAAAGGGAGGAGAAGG + Intergenic
1129236003 15:74224148-74224170 GAGGTGGGGCAGGCAGGTGCTGG + Intergenic
1129325686 15:74799111-74799133 GAGGGTGGCAAAGAAGGGACAGG + Intronic
1129332127 15:74833133-74833155 GAGGGAGGGAAGGAAGGAGCAGG - Intergenic
1129373141 15:75110374-75110396 GGGAGGGGCAGGGAAGGTGATGG - Intronic
1129442139 15:75588991-75589013 GAGGAGGGGAAGGAAGGGGAGGG + Intergenic
1129596548 15:76968834-76968856 GAGAGGGGCATGAGAGGTGCTGG + Intergenic
1129672730 15:77616136-77616158 GAGGGGCTCAGGGAAGGGGCGGG + Intronic
1129677396 15:77639411-77639433 AAGGGGGGCAAGGAATGGCCCGG + Intronic
1129803980 15:78438639-78438661 GACGGGGGCCAGGAAGCCGCTGG - Intronic
1129847990 15:78776888-78776910 GAGGGGGGCAGGGTGGGTGGCGG - Intronic
1130253925 15:82317047-82317069 GAGGGGGGCAGGGTGGGTGGCGG + Intergenic
1130418555 15:83717547-83717569 GAAGGGAGAAAAGAAGGTGCGGG + Intronic
1131047700 15:89326613-89326635 CAGGGTGTCCAGGAAGGTGCTGG + Exonic
1131075039 15:89490211-89490233 GATGAGGGCAGGCAAGGTGCAGG - Intronic
1131298476 15:91173267-91173289 GAGGAGGGCAAGGAGAGTGCAGG + Intronic
1131676540 15:94675950-94675972 GTGGAGGGCAAGGAAGGTGAAGG - Intergenic
1132704400 16:1236904-1236926 GGAGGGGGCAGGGCAGGTGCGGG + Intergenic
1132707116 16:1249521-1249543 GGAGGGGGCAGGGCAGGTGCGGG - Intergenic
1132767770 16:1543185-1543207 GAGGAGGAGAAGGAGGGTGCGGG - Intronic
1133043331 16:3072404-3072426 GGGTGGGGCAAGGGAGGTGGAGG + Intronic
1133311026 16:4847096-4847118 GAGAGGGGAAGAGAAGGTGCCGG - Intronic
1133522355 16:6571301-6571323 GGGAGGAGCAAGGAAGCTGCAGG + Intronic
1134004248 16:10807322-10807344 GTGGGGGGCAAGGAAGGAGAGGG - Intronic
1134629270 16:15745243-15745265 GAGGGGGGAAGAGAAGGTGCGGG + Intronic
1134849936 16:17471037-17471059 GAGGAGGGAAAGGAAGGGGGTGG + Intergenic
1134903777 16:17961770-17961792 GAGGGAGGCAAAGAAAGTGAGGG + Intergenic
1136236116 16:28914592-28914614 GAAGGGGGCAGGGAAGAGGCTGG + Intronic
1136398731 16:30006549-30006571 GAGGGAGGCCAGGGAGGGGCTGG - Intronic
1136500110 16:30665709-30665731 GAGGGGGCCAGGGCAGGTCCTGG + Intronic
1137029154 16:35506271-35506293 GAGGGGGGCAAGAAAAGGGGCGG + Intergenic
1137258260 16:46796432-46796454 GAGGGGAGCTAGGGAGATGCTGG + Intergenic
1137606083 16:49787738-49787760 GTGGCGTGCAAGGAGGGTGCTGG - Intronic
1138486723 16:57349915-57349937 GATGGAAGGAAGGAAGGTGCAGG - Intergenic
1138656185 16:58492881-58492903 GAGGAGGGAAAGGATGGGGCTGG - Intronic
1138808417 16:60120606-60120628 GAGGGGGAGCAGGAAAGTGCTGG + Intergenic
1138829363 16:60358862-60358884 GAAGGGGGCCTTGAAGGTGCTGG - Exonic
1139363640 16:66419330-66419352 GAGGAGGGGAGGGAAGGTGAGGG + Intergenic
1139993895 16:70962181-70962203 GAGGGGGACAAGGGAGATGGAGG + Intronic
1141472590 16:84249601-84249623 GGGGAGAGAAAGGAAGGTGCTGG - Intergenic
1141720835 16:85754387-85754409 GTGCGGGGAAAGGCAGGTGCTGG + Intergenic
1141815030 16:86404024-86404046 CAAGGAGGGAAGGAAGGTGCCGG + Intergenic
1141992722 16:87619842-87619864 ATGGGGCGCAAGGAAGGGGCTGG + Intronic
1142160644 16:88555739-88555761 GCGGGAGGCATGGAAGGGGCAGG - Intergenic
1142267325 16:89070676-89070698 GGGGGGGGCAAGGGGGGTGGGGG - Intergenic
1142285968 16:89171691-89171713 GAGGGGGGCGGGGAGGGGGCGGG - Intergenic
1143378337 17:6480327-6480349 GAGGGGGAAAAGGAAGGCCCAGG + Intronic
1143577355 17:7802023-7802045 AAGGGGGGCAGGGGATGTGCAGG + Intronic
1144038919 17:11391216-11391238 GAGGGTGGGCAGGAAGGTGATGG + Intronic
1144052435 17:11508564-11508586 GAGGTGGGAAAGGAAGGGGAGGG - Intronic
1144077164 17:11729727-11729749 GAGGGGGACAAGGATGATGCTGG - Intronic
1144882101 17:18435646-18435668 GAGGGGGGCAGAGAAGCTGAGGG - Intergenic
1144954680 17:19013088-19013110 GAGGGGGGCAAGGGAGGCTCAGG + Intronic
1145150132 17:20508740-20508762 GAGGGGGGCAGAGAAGCTGAGGG + Intergenic
1145349587 17:22069049-22069071 GTGGGTGCCAAGGAACGTGCTGG + Intergenic
1145815262 17:27790592-27790614 GATGGGGGCAGGGAAGGTATAGG - Intronic
1145941531 17:28745536-28745558 GAGGGGGGCCAAGAAGGTGGTGG - Intronic
1146162064 17:30565385-30565407 GAGGGGGGCAGAGAAGCTGAGGG + Intergenic
1146280290 17:31540248-31540270 GCGGGGTGCAGGGGAGGTGCTGG + Intergenic
1146511081 17:33449265-33449287 GAGGGGAGGAAGGAAGCAGCTGG - Intronic
1146520400 17:33521597-33521619 GAGATGGGCAAGGAAGATGTTGG + Intronic
1147220406 17:38925503-38925525 GTGGGGGGGCAGGAAGCTGCTGG + Intergenic
1147341761 17:39756530-39756552 GAGGGGAAGAAGGAGGGTGCAGG + Intergenic
1147401777 17:40184551-40184573 GAGGAGGACAAAGAAGGTGAAGG - Intronic
1147578463 17:41615795-41615817 GAGGGGGGCAGAGAAGCTGAGGG + Intronic
1147586357 17:41655765-41655787 GTGGGTGGCAGGGAAGGTGGAGG + Intergenic
1147629343 17:41919591-41919613 AAGTGGGGCTAGGAGGGTGCAGG + Intronic
1147694156 17:42338609-42338631 GCGGGGCGCAAGGGAGGTACGGG - Intronic
1147739204 17:42660719-42660741 GAGTGGGGGAAGGAATGGGCAGG + Intronic
1147892112 17:43724753-43724775 AAGGAAGGCATGGAAGGTGCTGG - Intergenic
1147921586 17:43920581-43920603 GAAGGGGGGAAGGAGAGTGCTGG + Intergenic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1147965811 17:44193657-44193679 GTGAGGGGCAGGGAAGGTGGCGG + Exonic
1147976163 17:44249457-44249479 GAGGGTGGGAAGGTAGGGGCGGG - Exonic
1148054862 17:44787876-44787898 GAGGCGAGCAGGGAAGGGGCAGG - Intergenic
1148084436 17:44985438-44985460 GAGGCGGGTAAGGAAAGTGCTGG + Intergenic
1148456332 17:47813406-47813428 GTGGGGGGCAAGGAAGGTGCAGG + Intronic
1148618775 17:49019011-49019033 GAGGAGGGCAAGGTGGGAGCAGG - Intronic
1148680199 17:49469480-49469502 GAGGGAGTCAAAGAAGGTGGAGG - Intronic
1149361852 17:55903423-55903445 GAGGCGGTCCAGGAACGTGCTGG + Intergenic
1149518072 17:57295309-57295331 GAGGGGAGCTAGAAGGGTGCTGG + Intronic
1149855364 17:60078402-60078424 GAGGGAGTGAAGGAGGGTGCGGG + Intronic
1149895070 17:60422662-60422684 GAGGGAGGGAAGGAGGGTCCCGG + Intronic
1150382569 17:64732488-64732510 GCTGGGGGAAGGGAAGGTGCAGG + Intergenic
1150437795 17:65167616-65167638 GATGGTGACAAGGAAGATGCTGG - Intronic
1150644269 17:66968473-66968495 GAGGAGGGGAGGGAAGGTGAGGG - Intronic
1150773654 17:68062060-68062082 GCTGGGGGAAGGGAAGGTGCAGG - Intergenic
1151206643 17:72512959-72512981 GAGGGGGGCAAGGAGAGTCACGG + Intergenic
1151351329 17:73533729-73533751 GAGAGCTGCAAGAAAGGTGCTGG - Intronic
1151445423 17:74160574-74160596 CAGGGTGGCATGGCAGGTGCTGG - Intergenic
1151495064 17:74454014-74454036 GTGGGGGGCAGTGAAGGTGGGGG + Intergenic
1151935974 17:77261585-77261607 GAGTGGGGGAGAGAAGGTGCGGG - Intergenic
1152003493 17:77662212-77662234 GAAGGGGAGAAGGAAGGAGCAGG - Intergenic
1152017770 17:77762983-77763005 GATGGGGGCAGGGCAGGAGCTGG + Intergenic
1152241026 17:79161238-79161260 GAGTGAGCCAAGGAAGGGGCCGG + Intronic
1152477295 17:80526548-80526570 GATGGGGGCGAGGAAGATGGTGG + Intergenic
1152558656 17:81067152-81067174 GTGGGGGGGAAGGGAGGTACAGG - Intronic
1152581287 17:81166483-81166505 GAGGGGGGCACGGAGGCTGGCGG + Intergenic
1152593148 17:81223310-81223332 GGGCGGGGCAAGGCAGGTGTGGG + Intergenic
1152778345 17:82215681-82215703 GGGGGGGGCAGGGAAGGAGGGGG - Intergenic
1152797468 17:82315262-82315284 TGGTGGGGCAGGGAAGGTGCTGG + Exonic
1152821802 17:82441298-82441320 GAGGGGGGCAGGCATGGGGCGGG + Intronic
1152928820 17:83099865-83099887 GAGGGGCGGAAGGCAGGGGCGGG + Intergenic
1153174763 18:2358236-2358258 GAGGGTTGCAAGAAAGGTGAGGG - Intergenic
1153324718 18:3806794-3806816 GAGGGGAGCAGGGAAGGCCCTGG - Intronic
1153487897 18:5619162-5619184 GGTGGGGGCAGGGAAGGTGGGGG + Intronic
1154492937 18:14934979-14935001 GAGGGGGCCTGGGAGGGTGCAGG - Intergenic
1155630543 18:27887541-27887563 GAGGGAGGCAGGGAAGGAGGAGG - Intergenic
1156539950 18:37899752-37899774 GATGGAGGCAAGGAATGAGCTGG + Intergenic
1157292358 18:46419222-46419244 GAGGGGGACTTGGGAGGTGCAGG + Intronic
1157493410 18:48139155-48139177 GAGGAGGGCATGTCAGGTGCGGG + Intronic
1157544623 18:48539243-48539265 GAAGGGGGCAGGGAAGGGGAAGG - Exonic
1157753110 18:50195306-50195328 GAGCGCGGCAGGGCAGGTGCGGG - Intergenic
1158187789 18:54791553-54791575 GAAGAGGGGAAGGGAGGTGCTGG + Intronic
1158221800 18:55158635-55158657 GAGGGGGGTTTGGAAGGTGGAGG - Intergenic
1158390911 18:57044230-57044252 AAAGGGGGAAAGGAAGATGCGGG + Intergenic
1158457540 18:57621554-57621576 GAGGGAGGGAGGGAGGGTGCTGG - Intronic
1158660585 18:59384033-59384055 GAGGGCGACAGGGAAGGTGGGGG - Intergenic
1159417670 18:68173609-68173631 GAGGGGGGCAAGGAAGTGTTGGG - Intergenic
1159848599 18:73497642-73497664 TAGGGGGGGAAGAATGGTGCTGG + Intergenic
1160033510 18:75281808-75281830 AAGGGGGGCATGCTAGGTGCGGG + Intronic
1160439596 18:78879268-78879290 GTGCGGGACGAGGAAGGTGCAGG + Intergenic
1160596092 18:79975472-79975494 GTGAGGGGCAAGGAGGCTGCAGG - Intronic
1160785784 19:899731-899753 GTGGGGGGCCAGGGAGGTCCAGG + Intronic
1160797867 19:954100-954122 GGGAGGGGCCAGGAGGGTGCTGG + Intronic
1160815252 19:1032473-1032495 GAGCGGAGCAGGGATGGTGCTGG + Intronic
1161085541 19:2333280-2333302 GAGGTGGGGACGGCAGGTGCGGG + Intronic
1161093857 19:2377513-2377535 GAGAGGGGAAGGGAAGGTGAGGG - Intergenic
1161634232 19:5377207-5377229 GGGGAGGGCAGGGAAGGGGCAGG + Intergenic
1161715409 19:5873591-5873613 GAGGAGGGGATGGAAGGTTCTGG - Intronic
1161998869 19:7730885-7730907 GAGGGCGGCGAGGATGGGGCGGG + Intronic
1162007301 19:7788748-7788770 GAGGGAGGCGAGGATGGGGCGGG - Intergenic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162199661 19:9011028-9011050 CAGAGAGGCAAGGAAGGGGCTGG + Intergenic
1162342893 19:10102541-10102563 GAGGGTGGGAAGGTAGGTGGAGG - Intronic
1162562737 19:11426862-11426884 GAGGTGGCCAAGGTAGGGGCGGG - Exonic
1162594013 19:11613140-11613162 GAGGGGGGGAAGGGAGGGGAGGG - Intronic
1162731849 19:12722914-12722936 GAAGGTGACAAGGAGGGTGCTGG - Intronic
1162792873 19:13072113-13072135 GAGGGGGGCCAGGCAGGTTGTGG - Intronic
1162861161 19:13506483-13506505 GAGGGGCGGGAGGAGGGTGCGGG + Intronic
1163117547 19:15197583-15197605 GTGGGGGTGAAGGAAGGTGGAGG + Intronic
1163214004 19:15862884-15862906 GAGTGGGGAAAGGGAGGTGGGGG - Intergenic
1163418360 19:17200614-17200636 GAGGGGGGACAGGAAGCAGCCGG - Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163601174 19:18250088-18250110 GATGGGGGCATGGATGGGGCTGG - Intronic
1163830464 19:19545003-19545025 GGGCGGGGCAAGGAAGGGGCCGG - Exonic
1164082286 19:21868934-21868956 GAGGGGGGCATAGAAAGTGTGGG - Intergenic
1164588746 19:29494655-29494677 GAGGGGGGGAAGGAAGGAACGGG + Intergenic
1165034359 19:33022370-33022392 GAGGGGGGCAGAGGAGGTGGGGG - Intronic
1165295913 19:34925742-34925764 GAAGGGGGAAAGGGAGGTGCTGG - Intergenic
1165331021 19:35141283-35141305 GAGGGGGGCTAGGGAGAGGCGGG - Intronic
1165593174 19:36988500-36988522 GAAGGAAGCAGGGAAGGTGCGGG + Intronic
1166350491 19:42195714-42195736 GAGGGAGGGAGGGAAGGTGGTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166749785 19:45159297-45159319 CGGGGGAGCAGGGAAGGTGCAGG + Intronic
1166753356 19:45175758-45175780 GAGGGAGACAAGGCAGGTGTTGG + Intronic
1167008239 19:46788798-46788820 GGGCGGGGCCAGGAAGGGGCGGG + Intergenic
1167210900 19:48133511-48133533 GAGGTGGCCAGGGAAGGTACAGG - Intronic
1167238687 19:48330494-48330516 GAGGGGGGCCGGGAAGGGGCGGG - Exonic
1167270171 19:48501947-48501969 GAGGGGGGCAGGGGAGGGGGAGG - Intronic
1167378551 19:49125535-49125557 GCGGGGGACAAGGAAGGGGCGGG - Intronic
1167413879 19:49360606-49360628 GTGGTGGGGAAGGAAGGTGTGGG + Intronic
1167437146 19:49486094-49486116 GAGGGGCCCAAGGAAGGGACCGG - Exonic
1167511244 19:49896343-49896365 GAGGGAGGCAGGGACGGTCCAGG - Intronic
1167616420 19:50536805-50536827 AAGGGTGGGAAGGAAGGGGCTGG + Intronic
1167666961 19:50827866-50827888 GCAGGGTGCAAGGAAGGTGTAGG - Intronic
1167685515 19:50953240-50953262 GGGGGAGGCAGGGAAGGGGCTGG - Intergenic
1168069932 19:53943491-53943513 GAGGGGGGCAGGGGAGGGACGGG + Exonic
925010304 2:479887-479909 GAGTGGGGAAAGGAGAGTGCAGG - Intergenic
925294845 2:2769549-2769571 CAGGGTGGCAAGGAGGGTGACGG + Intergenic
925313734 2:2906608-2906630 GAGGGGGTGGAGGAAGGTGTAGG - Intergenic
925313769 2:2906699-2906721 GAGGGGGTGGAGGAAGGTGTAGG - Intergenic
925313787 2:2906745-2906767 GAGGGGGTGGAGGAAGGTGTAGG - Intergenic
925313874 2:2906974-2906996 GAGGGGGTGGAGGAAGGTGTAGG - Intergenic
925313891 2:2907019-2907041 GAGGGGGTGGAGGAAGGTGTAGG - Intergenic
925313908 2:2907064-2907086 GAGGGGGTGGAGGAAGGTGTAGG - Intergenic
925313943 2:2907154-2907176 GAGGGGGTGGAGGAAGGTGTAGG - Intergenic
925625888 2:5841919-5841941 GAGGGGAGGAAGGAAGGAGGAGG + Intergenic
925671599 2:6315611-6315633 GATGGGAGCAGGGAAGGTGGAGG + Intergenic
925910074 2:8568061-8568083 GAGAGGGGAAAGGAGGCTGCTGG + Intergenic
926136103 2:10337739-10337761 GAAGGTGGGAAGGAAGGGGCTGG - Intronic
926203875 2:10821155-10821177 GAGAGGGGGAAGGAAGGAGGTGG - Intronic
926921827 2:17946764-17946786 GAGGGAGGGAAGGAAGGAGAGGG - Intronic
927060667 2:19416406-19416428 GAAGGGGGGAAGGAAGGAGAAGG - Intergenic
927104508 2:19811735-19811757 CAGTGGGGCAAGGAAAGAGCTGG - Intergenic
927810980 2:26180021-26180043 GAGGGGGGCAGGCAAGAAGCAGG - Intronic
927964777 2:27262250-27262272 GGGGGCGGCGAGGAAGGAGCAGG - Intronic
928378581 2:30799163-30799185 GAGGGGGAAAAGGAAGGAGGAGG + Intronic
928537999 2:32258507-32258529 GAAGGGGGGAAGGGAAGTGCTGG - Intronic
929604531 2:43226087-43226109 GAGGGCGGCAAGGAGGGCGCCGG - Intronic
929753380 2:44740745-44740767 GAGAGGGACAAGGAAGTTGAGGG + Intronic
930005873 2:46896215-46896237 GAGGAGGCCAAGGAAGGAGCTGG - Intergenic
930094500 2:47556658-47556680 GAGAGGGGCAAGGAAGTTAAGGG + Intronic
930453896 2:51581202-51581224 GAGGGGGGGCAGAGAGGTGCTGG + Intergenic
930956062 2:57204399-57204421 GAGGGGGTCAAGGAGTGTACTGG + Intergenic
931288260 2:60850360-60850382 GAGAGGGGCATGGCAGGAGCAGG + Intergenic
931991801 2:67797593-67797615 GAAGGGTGGAAGGAAGGTTCAGG + Intergenic
932341181 2:70963448-70963470 GTGGGGGGCATGGATGGTGGAGG - Intronic
932417826 2:71584363-71584385 GAGGAGGGGAAGGAGGGTGCTGG - Intronic
933069276 2:77836830-77836852 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
934058145 2:88269783-88269805 GAGAGGGGTGAGCAAGGTGCTGG + Intergenic
934461840 2:94216996-94217018 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
934518090 2:95001355-95001377 GAGGGGGTCATGGAGGGTGAGGG + Intergenic
934571381 2:95375113-95375135 GGGGAGGGCAAGGAAGAGGCTGG - Intronic
934902629 2:98172595-98172617 GAAGTGGGGAAGGAAAGTGCTGG - Intronic
935131477 2:100264384-100264406 GAGGGAGGCAAGGGAGGAACGGG + Intergenic
936059175 2:109283326-109283348 TGGGGTGGCAAGGAAGGAGCAGG - Intronic
936141870 2:109947897-109947919 CAGGAGGGCAACGAAGGGGCAGG - Intergenic
936178558 2:110245845-110245867 CAGGAGGGCAACGAAGGGGCAGG - Intergenic
936202820 2:110423587-110423609 CAGGAGGGCAACGAAGGGGCAGG + Intronic
936250875 2:110867180-110867202 GAGGGAGGCAAGGAAGGGAGTGG + Intronic
936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG + Intergenic
937034526 2:118769808-118769830 GAGGGAGGAAAGGAAGGAGAGGG + Intergenic
937743772 2:125386839-125386861 GAGAGGGGGCAGGAAAGTGCTGG - Intergenic
937913398 2:127087262-127087284 GGGGAGGGGAAGGAAGTTGCAGG + Intronic
937925870 2:127166856-127166878 GGGTGGGGCAAGGATGGGGCAGG - Intergenic
938163784 2:129009145-129009167 GAGGATGCCCAGGAAGGTGCAGG + Intergenic
938392874 2:130918614-130918636 GAGGGCGGCAGATAAGGTGCTGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
938938925 2:136152199-136152221 GAGGGAGGGAAGGAAGGAGAGGG - Intergenic
939099478 2:137879931-137879953 GAGGGGTCCAAGGAAGGGGGAGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942135974 2:172925934-172925956 GAGGGAGGGAAGGAAGGAGGGGG + Intronic
942965846 2:181891886-181891908 GAGGGAGGGAAGGAAGGGGAGGG - Exonic
943669902 2:190649211-190649233 GAGGGGGGAAGGGAAGGTGGTGG - Exonic
943763163 2:191631722-191631744 GATGGGGGCAGGGAGGGGGCAGG + Intergenic
944154959 2:196598406-196598428 AAGGGGGGAAAGGAAGGGGAGGG + Intergenic
944534597 2:200696609-200696631 GAGGCTGGAAAGGAAGGTGGAGG + Intergenic
944677112 2:202042771-202042793 GAGAGGGGCAAGGGAGGGGTGGG + Intergenic
946016309 2:216606822-216606844 AAGGGGGGCCAGGAGGGGGCCGG - Intergenic
946187251 2:217988093-217988115 GACTGGGACATGGAAGGTGCAGG - Intronic
946800694 2:223413237-223413259 GAGGGAGGAAAGGCAGGTCCAGG - Intergenic
946832600 2:223741438-223741460 GAGGGGGGTCAGGGAAGTGCTGG - Intergenic
947479339 2:230483598-230483620 TAGGAGGGCAAGGATGGGGCAGG + Intronic
947505979 2:230708788-230708810 GAGGAGGAGAAGGAAGGGGCGGG - Intergenic
947827064 2:233113731-233113753 GAGAGAGGCAAGGATGGAGCTGG - Intronic
948297752 2:236875572-236875594 GAAGGGGACAGGGAAGGTCCTGG + Intergenic
948338992 2:237233930-237233952 AAGGGAAGCCAGGAAGGTGCAGG + Intergenic
948752183 2:240139218-240139240 GAAGTGGGCAAAGAAGGTTCGGG + Exonic
948811709 2:240481752-240481774 GGGAGGGGCTAGGAAGGTGCAGG + Intronic
948961694 2:241343991-241344013 GAGGGCGGCAATGAAGCTGCTGG - Intronic
949052175 2:241903259-241903281 GGGCGGGGCAAGGAGGGTGCTGG - Intergenic
1168846690 20:949964-949986 GGGCGGGGCAGGGAAGGTACTGG - Intergenic
1169028061 20:2386378-2386400 GAGTTGGGCAGGGGAGGTGCCGG + Intronic
1170682761 20:18541164-18541186 GAGAGAGGTAAGGAAGCTGCAGG - Intronic
1170840877 20:19924032-19924054 GGTGGGGGTAAGGAAGGTGGGGG - Intronic
1172191308 20:33063446-33063468 GTGGGAGGCAGGGAAGGGGCTGG - Intronic
1172303936 20:33868436-33868458 GAGGTGGACAGGGAAGGAGCAGG - Intergenic
1172444496 20:34985998-34986020 GAGGTGGGCAGGGAGTGTGCAGG - Intronic
1172693211 20:36804513-36804535 GAGGAAGGGAAGGAAGGTGGGGG - Intronic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1172836982 20:37879312-37879334 GAGTGGGGCAGGGAAGGCCCAGG - Intergenic
1173034541 20:39395946-39395968 CAGAGGGGAAAGGAAGGTGGAGG + Intergenic
1173317699 20:41959887-41959909 GAGTGGGGCCAGGAGGGAGCTGG - Intergenic
1173440055 20:43067990-43068012 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440086 20:43068064-43068086 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440096 20:43068086-43068108 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173518315 20:43680920-43680942 AAGGGGGGCAAGGAATGTCTTGG - Intronic
1174268526 20:49349824-49349846 GAGTTGGGCAATGAATGTGCGGG + Intergenic
1174292444 20:49518879-49518901 GAGGGGGCCACGGGAGCTGCTGG - Intronic
1174339293 20:49886091-49886113 GAGGGGGACGGGGCAGGTGCAGG - Intronic
1174476952 20:50802363-50802385 GCCAGGGGCAAGGCAGGTGCTGG + Intronic
1175214767 20:57386194-57386216 TAGGGGGCCTAGGCAGGTGCTGG - Intergenic
1175242257 20:57558450-57558472 GAGTGGCCCCAGGAAGGTGCAGG + Intergenic
1175423753 20:58851809-58851831 GAGAGGGGCTAGAAGGGTGCTGG + Intronic
1175427708 20:58879705-58879727 GAGGGGGGAAATGAAGCAGCAGG + Intronic
1175778391 20:61667127-61667149 GATGGAGGCAAAGAAGGGGCCGG + Intronic
1175831659 20:61967831-61967853 GGGAGGGGGAAGGAAGGTGCAGG - Intronic
1175892329 20:62321297-62321319 GAGGGGGCCAGTGAAGGTGTGGG + Intronic
1175907699 20:62389433-62389455 GAGGAGGGCCAGGTGGGTGCTGG + Exonic
1175962340 20:62643289-62643311 GAGGATGGAAAGGAAGGAGCAGG + Exonic
1176101813 20:63367901-63367923 GAGGTGGCCTTGGAAGGTGCAGG - Intronic
1176198246 20:63847832-63847854 GAGCAGGGAAAGGAAGGGGCCGG - Intergenic
1176228775 20:64019713-64019735 GAGGGGGTCAGGGAGGATGCCGG - Intronic
1176301561 21:5101348-5101370 GAGAGGGGCAGGGCAGGGGCAGG + Intergenic
1176301663 21:5101636-5101658 GAGAGGGGCAGGGCAGGGGCAGG + Intergenic
1176592931 21:8659978-8660000 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1176956853 21:15115527-15115549 GAGAAGGGCAAGGAGGGAGCAGG - Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1177116046 21:17088194-17088216 GAGGAGGGCAAGGAGGGAGGAGG + Intergenic
1177176202 21:17703258-17703280 AAGAGGGTCAAGGGAGGTGCTGG - Intergenic
1177234422 21:18368528-18368550 GAGAGTGGCAAGTAAGGAGCAGG + Intronic
1178357543 21:31921369-31921391 GACGTAGGGAAGGAAGGTGCGGG + Intronic
1179415998 21:41199297-41199319 GAGGGAGGGTAGGAAGGCGCAGG - Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179626737 21:42653471-42653493 AAGAGGGGGAAGGGAGGTGCAGG + Intergenic
1179708500 21:43195900-43195922 GAGGTGGGGAAGGAAGGGGCGGG + Intergenic
1179855368 21:44160263-44160285 GAGAGGGGCAGGGCAGGGGCAGG - Intergenic
1179855470 21:44160551-44160573 GAGAGGGGCAGGGCAGGGGCAGG - Intergenic
1180275784 22:10637121-10637143 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1181003336 22:19998226-19998248 GAGGGGGGAAAGGGCGTTGCAGG - Intronic
1181278573 22:21702793-21702815 GAAGCGGGGCAGGAAGGTGCAGG + Intronic
1181354408 22:22289758-22289780 GAGGATGGCAAGGCAGGTCCAGG + Intergenic
1181805945 22:25374539-25374561 GAGGGTGGCCAGGAAGGTCACGG - Intronic
1182074240 22:27484037-27484059 GAGGGGGTCCAGGAAGGAGCAGG - Intergenic
1182103302 22:27672105-27672127 GAGGGAGGGAAGGAAGGGGAGGG + Intergenic
1182486342 22:30641302-30641324 GAGGGAGGGAAGGAGGGAGCTGG - Intronic
1182662165 22:31932961-31932983 GAGGGAGACCAGGAAGGGGCGGG + Intergenic
1182747711 22:32618274-32618296 GAGTGGGGCGAGGAGGGTTCAGG + Intronic
1182829633 22:33294572-33294594 GAGGTGGGGAAGGGAGGTACGGG - Intronic
1183212213 22:36458087-36458109 GAGGCAGGCAGGGAAGGAGCCGG - Intergenic
1183296848 22:37034873-37034895 GAGGCAGGCAGGGCAGGTGCAGG - Intergenic
1183614511 22:38935336-38935358 GCGTTGGGCAAGGAAAGTGCAGG + Intergenic
1183710686 22:39501741-39501763 GAGGGAGGCGAGGAAGGGGCTGG + Intronic
1183943192 22:41308217-41308239 GAGGGCTGCAGGGAAGGTGGGGG + Intronic
1184089382 22:42284197-42284219 GAGGGGGGCAGGGGAGGGGCGGG + Intronic
1184405913 22:44300742-44300764 GAGGGGTGCCAGTAAGGTGGAGG + Intronic
1184497741 22:44852219-44852241 GAAGGGAGGAAGGAAGGTGAAGG + Intronic
1184532749 22:45066765-45066787 GTGGGCGGCAGGGAAGGTGTTGG + Intergenic
1184660086 22:45961626-45961648 GGGGTGGGCAAGGACGGGGCTGG + Intronic
1184729869 22:46366207-46366229 GAGGCGGGGAGGGAAGGTGCGGG + Intronic
1184783289 22:46659652-46659674 GAGGCGGGCAAGGAAGAAGTGGG - Intronic
1185037060 22:48484891-48484913 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1185309904 22:50148510-50148532 AAGGGAGGTAAGGGAGGTGCAGG - Intronic
949414540 3:3800375-3800397 GAGGAGGGCAAGGAAGGTGGCGG + Intronic
949778051 3:7653951-7653973 GAAGGGGGCAAGGGAGTAGCAGG - Intronic
950458421 3:13106255-13106277 GTGGGAGCCCAGGAAGGTGCTGG - Intergenic
950715170 3:14842662-14842684 GAGAAGGACAAGGAAGCTGCTGG - Intronic
950878386 3:16299976-16299998 GAGGTGGGCAGTGCAGGTGCTGG + Intronic
952580180 3:34824164-34824186 GAAGGGGGGAAGGGAAGTGCTGG + Intergenic
952810009 3:37393532-37393554 AAGAGGGGTAAGGAAGCTGCAGG + Intronic
952958309 3:38574400-38574422 GAGGGGGTTCTGGAAGGTGCTGG - Intronic
953193526 3:40711704-40711726 CAGGGAGGCATGCAAGGTGCTGG - Intergenic
953740857 3:45537902-45537924 GAGGAGGGGAAGGAAGGGGGTGG + Intronic
953875052 3:46661955-46661977 GGGGAGGGCATAGAAGGTGCTGG + Intergenic
953904376 3:46861149-46861171 GAGGGGGGCAAGGAGGCAGGAGG - Intronic
954134029 3:48573817-48573839 GATGGGGGCAAGACAGGTGAAGG + Intronic
954507359 3:51090035-51090057 GAGGTGGGCAAGCAAGCAGCTGG - Intronic
954963933 3:54593462-54593484 GAGGGAGGGAAGGAAGGTGAAGG + Intronic
955065910 3:55533591-55533613 GAGGTGAGAAAGGAAGGTGATGG + Intronic
955216648 3:56989706-56989728 GAGTGGGGCAGGGGTGGTGCTGG - Intronic
955566947 3:60257624-60257646 GAGGAGGACAAGGAAGGTGGAGG + Intronic
956571554 3:70702182-70702204 GACGGAGCCAAGGAAAGTGCTGG + Intergenic
956904832 3:73754963-73754985 CAAGGTGGCAAGGAAGGTGTTGG - Intergenic
957507477 3:81141603-81141625 GAGGGAGGCAAGGAAGGAAAGGG + Intergenic
959254978 3:103998178-103998200 GAGGAGGGCAAGAGAGGTGAAGG + Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960867570 3:122217461-122217483 GAAAGGGGCAAGGAAGATTCAGG + Intronic
961149781 3:124628202-124628224 GAGGGAGGGAAGGAAGGAGGGGG - Intronic
961149822 3:124628313-124628335 GAGGGAGGGAAGGAAGGAGGGGG - Intronic
961175843 3:124834519-124834541 GAGGGAGGCGAGGAAGGGGAGGG + Intronic
961200822 3:125043871-125043893 GAGGGGGGAGAGGCGGGTGCAGG + Intronic
961438170 3:126933534-126933556 GAGGAAGGCAAAGAAGGAGCCGG + Intronic
962250465 3:133833095-133833117 GAGAGGGGCAGACAAGGTGCAGG - Intronic
962356780 3:134700856-134700878 GAGGGGAGCCAAGAAGGAGCTGG - Intronic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
963604786 3:147405050-147405072 GAGGGGAGCCAGAAAGGTGCAGG - Intronic
963664268 3:148162530-148162552 GAGGGGGCTAGGGAAGGTTCAGG + Intergenic
966329603 3:178795600-178795622 TAGGGGGCCAAGGAATGTGGTGG + Intronic
966925432 3:184641523-184641545 GAGGGGGGCGAGGAAGGGTCAGG + Intronic
968071829 3:195788952-195788974 GAGGGTGGGATGAAAGGTGCCGG + Exonic
968188740 3:196652044-196652066 GAGGAGGGCAGGGAAGGGGAAGG + Intronic
968201283 3:196757642-196757664 GAGTGGGGCCAGAATGGTGCAGG - Intronic
968493054 4:900829-900851 GAGGGAGGAAAGGAAGGAGAAGG + Intronic
969175953 4:5399296-5399318 GAGGTGGGGAAGGAGGGTGGGGG - Intronic
969265139 4:6059549-6059571 GAGGGTGCCAAGGAGGGTGTGGG - Intronic
969418047 4:7073923-7073945 GAGGGGGCCCAGGAAAGTGGGGG - Intergenic
969454875 4:7295098-7295120 GAGGAGGGAGAGGAAGGAGCTGG - Intronic
969538326 4:7770236-7770258 GGGGGTGGCAAGGCAGGAGCTGG + Intronic
969607591 4:8210252-8210274 AAGGGGGCCCAGGAAGCTGCTGG + Intronic
969990425 4:11256649-11256671 GAGGGAGACAAGGAAGGAGGAGG - Intergenic
971391879 4:26193772-26193794 GAGGGGGCTATGGAAGGAGCTGG - Intronic
971553976 4:27988862-27988884 GGGGAGGGAAAGGAAGGTGAGGG - Intergenic
972778670 4:42266283-42266305 GGTGGGGGGAAGGAAGGTGGGGG - Intergenic
974833384 4:67216411-67216433 GAGGGGGGGAAGGGAGGGGGAGG + Intergenic
975584965 4:75940435-75940457 GAGGCCCGCAAGGAAGGCGCGGG + Intronic
975720917 4:77247869-77247891 GAGTGGGGCAAGGAAGTTGAAGG + Intronic
975724099 4:77275490-77275512 GAGTGGGGCAAGGAAGTTGAAGG + Intronic
975912688 4:79286362-79286384 GAGGTGGGCAAATAAGGTGAAGG + Intronic
976221928 4:82762958-82762980 GAGGGGGACCAGGAAGGCGATGG - Intronic
978379440 4:108111601-108111623 GAGGGAGGCAAGAAAGGTGCTGG + Intronic
978431779 4:108640350-108640372 GAGGAGAGCAGGGAAGGTGGTGG - Intergenic
979465491 4:121032745-121032767 GAGTGGGGGAAGGAAGTGGCTGG + Intergenic
979506406 4:121502621-121502643 GAGGGAGGGAAGGAAGGAGGGGG - Intergenic
979713004 4:123802887-123802909 GAAGAGGGAAAGGAAGGTGTTGG - Intergenic
979952081 4:126906016-126906038 CGGGTGTGCAAGGAAGGTGCAGG - Intergenic
980236980 4:130120902-130120924 GTGGGTGGGAAGGAAGGTGGAGG + Intergenic
980286294 4:130782726-130782748 GAAGGGGGACAGGGAGGTGCTGG + Intergenic
980716421 4:136636084-136636106 GAAGGGGGTAAGGGAAGTGCTGG + Intergenic
981242078 4:142490029-142490051 GAGGGGGGAAAGGAGGGTCTTGG + Intronic
981247751 4:142560188-142560210 GAGGCGGGGAAGGAAAGCGCAGG - Intronic
981491198 4:145341386-145341408 ATGGTGGGCAAGGAAGGTTCTGG + Intergenic
981509858 4:145544181-145544203 GAGGGAGGCTAGGAAGGTGTGGG + Intronic
981704656 4:147646661-147646683 GAGGGGGGGGAGGGGGGTGCAGG + Intronic
982036358 4:151349814-151349836 GAGAGAGGTAAGGAAGCTGCAGG + Intergenic
982226251 4:153170145-153170167 GAGGGGGAAAAGGGAGGTGGAGG + Intronic
985409698 4:189670275-189670297 GAGGTGGAGAAGGAAGGGGCTGG - Intergenic
985509280 5:303058-303080 GAGGAAGGAAAGGAAGGAGCTGG + Intronic
985724104 5:1506624-1506646 GGGGTGGCCAAGGGAGGTGCTGG + Intronic
985738993 5:1603834-1603856 GAGGAAGGAAAGGAAGGAGCTGG - Intergenic
985771770 5:1816242-1816264 GCGGGGGGCAGGGAAGGAGAAGG + Exonic
985783975 5:1884816-1884838 GAGGGGAGGAAGGAGGGTGGGGG - Intronic
986348823 5:6858540-6858562 GCGGAGGCCAAGGAAGGGGCAGG - Intergenic
986731460 5:10637718-10637740 GTGGGGGGCAGGGACGCTGCGGG - Intronic
986848106 5:11779490-11779512 GAGGGTGCCCAGCAAGGTGCTGG + Intronic
987766705 5:22240952-22240974 GAGAAGGGCAAGGAAGGAGGAGG + Intronic
992523050 5:77576287-77576309 GAGGGGGGTAGTGAAGGTGTGGG - Intronic
992748329 5:79840066-79840088 GAGGTTGGGGAGGAAGGTGCTGG - Intergenic
992962807 5:81972356-81972378 GAGTGGGGCAAGGACCGTGTGGG - Intronic
993190620 5:84674737-84674759 AAGGAGGGCAAGGAAGCTCCAGG + Intergenic
994185115 5:96807781-96807803 GACGGGCGCAGGGAAGGGGCGGG + Intronic
995750906 5:115452303-115452325 GAGTGGTGCCTGGAAGGTGCGGG - Intergenic
995814872 5:116156859-116156881 AAAGGGGGCAAGGACTGTGCAGG - Intronic
996820651 5:127623089-127623111 GAGGAGGCCAGGGAAGGGGCAGG + Intergenic
997354807 5:133255379-133255401 GAGGAGGGCAAGGGAGTTGGGGG + Intronic
997364638 5:133318214-133318236 GAGGGATGCAAGCAAGGTGAGGG - Intronic
997419777 5:133756658-133756680 GAGGTGGGGGAGGAGGGTGCGGG + Intergenic
997528962 5:134570602-134570624 GAGGTGGGCAGGGAGGCTGCAGG - Intronic
997660084 5:135582668-135582690 GTGGGGAGCATGGCAGGTGCTGG - Intergenic
997721408 5:136080813-136080835 GAGGGGAGGCAGGAGGGTGCGGG + Intergenic
997852626 5:137346313-137346335 GAGGGGTGCAGGGAAGGAGGGGG - Intronic
999007365 5:147997179-147997201 GAAGGGGGAAAGGCAAGTGCTGG - Intergenic
999184767 5:149698852-149698874 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
999654953 5:153802323-153802345 GAGGAGGGAAAGGAAGGGGAGGG - Intronic
999715316 5:154355493-154355515 GAGGGAGCCAAGGAAGGGCCAGG + Intronic
1000045429 5:157518307-157518329 GAGGTGGGGGAGGAAGGGGCGGG + Intronic
1000721187 5:164709383-164709405 GAGGGGTGAAATGAAGGTGTAGG - Intergenic
1001137866 5:169117407-169117429 GAGGGGGGCAGGGAGGGGACGGG - Intronic
1001198054 5:169691369-169691391 TCAGGGGGCAAGGAAGGTGATGG + Intronic
1001764607 5:174235563-174235585 GATGGGGGCAGGGGAGGTGGTGG - Intronic
1002138401 5:177122782-177122804 GACTGAGGCAAAGAAGGTGCGGG - Intergenic
1002539024 5:179893911-179893933 GAGGGAGGCAAGGAGGGAGGAGG + Intronic
1002600890 5:180353390-180353412 GAAGGGGGCGGGGAAGGGGCGGG + Intergenic
1003498721 6:6686984-6687006 GAGGAGGCCCAGGAAGGGGCGGG - Intergenic
1006174317 6:32112744-32112766 GAGTGGGGGAAGGAAGGAGGAGG + Intronic
1006192490 6:32218181-32218203 GAGTGGGGCAAGTCAGGAGCAGG - Intronic
1006371670 6:33648441-33648463 GAGGGGGGCAATGGAAGAGCAGG - Intronic
1006682644 6:35808125-35808147 GTGGGGAGCAAGGTAGGTGGTGG + Intronic
1007747501 6:44051905-44051927 GAGCCGGGCAAGGAGGGAGCTGG - Intergenic
1009194976 6:60673408-60673430 AAGGGGCACAAGGAAAGTGCTGG - Intergenic
1013619457 6:111873468-111873490 GAGGGGAGCGAGGAGGGGGCGGG + Intergenic
1015304606 6:131693880-131693902 TAGTGGGGGTAGGAAGGTGCTGG - Intronic
1015791637 6:136969464-136969486 GAGGAGGGTAACGAAGGTGGTGG + Intergenic
1016557319 6:145353175-145353197 GAGGGGGGCAAGGAAGTGCTCGG - Intergenic
1017041240 6:150310119-150310141 GAGGTGGGATAGGAAGGTGGTGG - Intergenic
1017106380 6:150892611-150892633 GAGGGGGACAAGTATGGGGCGGG - Intronic
1017521951 6:155210295-155210317 GAGGAGGGGAAGGAAGGGGAGGG - Intronic
1018462098 6:164008057-164008079 GAGGCTGGCCAGGAATGTGCAGG - Intergenic
1019136755 6:169913503-169913525 GAGGAGGGGAAGGGAGGGGCAGG + Intergenic
1019271207 7:150096-150118 GATGGGGGCAGGGACGTTGCCGG + Intergenic
1019346121 7:531648-531670 GAGGGGGACAGGGGAGGTGAGGG + Intergenic
1019346129 7:531666-531688 GAGGGGGACAGGGGAGGTGAGGG + Intergenic
1019346137 7:531684-531706 GAGGGGGACAGGGGAGGTGAGGG + Intergenic
1019346145 7:531702-531724 GAGGGGGACAGGGGAGGTGAGGG + Intergenic
1019346153 7:531720-531742 GAGGGGGACAGGGGAGGTGAGGG + Intergenic
1019346161 7:531738-531760 GAGGGGGACAGGGGAGGTGAGGG + Intergenic
1019602132 7:1890034-1890056 GAGAGGGGCCAGGAAGGCCCAGG - Intronic
1019730632 7:2627555-2627577 GAGAGAGGAAAGGAAGGTGGGGG + Intergenic
1019797598 7:3063327-3063349 GAGGTGGGCAGGGAAGGAGGTGG - Intergenic
1021011147 7:15467922-15467944 GAGGGTGGCAGGGAGGGTACGGG - Intronic
1021500933 7:21330666-21330688 CAGGGCGGCAGGCAAGGTGCAGG + Intergenic
1022089497 7:27098225-27098247 GAGGAGGGCAACCAAGGTACAGG - Intergenic
1022602321 7:31773047-31773069 GAGGGGTGCACGGAAGGAGCTGG - Intronic
1023861827 7:44221308-44221330 GAGTGGGGCCGGGAAGCTGCAGG - Intronic
1024095020 7:45976368-45976390 GAGGATGGCAGGGGAGGTGCTGG - Intergenic
1024593578 7:50912800-50912822 GGGTGGGGGAAGGAAGGTGTGGG + Intergenic
1024615673 7:51109503-51109525 GTGGGGGGCAAGGAGGGAGATGG - Intronic
1024677025 7:51646149-51646171 GAGGGGAGACAGGCAGGTGCAGG + Intergenic
1025076606 7:55949487-55949509 GAGGGGGGAAGGGAAGGGGAGGG - Intergenic
1025271389 7:57522234-57522256 GAGGGGTGGAAGGAAGGGGAGGG - Intergenic
1025992042 7:66503971-66503993 CAGGGGCGCATGGAAGGTGGTGG - Intergenic
1026036908 7:66836587-66836609 GAGGGAGGGAAGGGAGGAGCTGG - Intergenic
1026535895 7:71238279-71238301 GTGGGAGGCAGGGAAGGTGAGGG + Intronic
1026864763 7:73816723-73816745 GAGTGGGGCAAGGAGGTGGCAGG + Intronic
1026927554 7:74204504-74204526 GAGGGAGGGAAGGAAGGAGGGGG + Intronic
1027360210 7:77400399-77400421 GATGGGGGAAAGGTAGGTGAAGG - Intronic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1028993600 7:97076140-97076162 GAGCGGGGCAGGGAAGGGGCGGG - Intergenic
1029412809 7:100426757-100426779 GAGGAGGGCAAGGAAGGAGGGGG - Intronic
1030513670 7:110515858-110515880 GAGTGGGGCCAGGGAAGTGCTGG - Intergenic
1030787304 7:113678143-113678165 GAGAAGGGCATGGAAGGTGTGGG - Intergenic
1031031639 7:116741626-116741648 GAGGTGGGCAAGGCAAGTGGAGG + Intronic
1031163834 7:118202640-118202662 AAGGGAGGCTAGGAAGGTGAGGG + Intergenic
1032724363 7:134577130-134577152 GAGGGGGCCAAAGACAGTGCAGG - Intronic
1033441793 7:141386835-141386857 GATGAGGGCAAGGAAGTTCCAGG + Intronic
1033716256 7:144005705-144005727 GAGGGCGGGAAGGGGGGTGCGGG - Intergenic
1034474918 7:151276493-151276515 GAGGGAGGATAGGAAGGTACTGG + Intronic
1034607396 7:152329737-152329759 GAGGGAGGGAAGGAAGGAGATGG + Intronic
1035028918 7:155844784-155844806 GAGAGGGGCAAGGAGGGGACGGG - Intergenic
1035067858 7:156121313-156121335 GTGGGAGGAAATGAAGGTGCCGG - Intergenic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1035283345 7:157791540-157791562 GAGGGGGGGCAGGTGGGTGCAGG - Intronic
1035633467 8:1126467-1126489 GAGGGAGGCAAGGCAGGTGAGGG + Intergenic
1036521271 8:9493912-9493934 GAGGGTGGGGAGGAGGGTGCTGG - Intergenic
1036770376 8:11574902-11574924 GAAGTGGGCAGGGAAGGGGCTGG - Intergenic
1036940575 8:13048221-13048243 GAAGGGGGCAAGGATGGAACTGG + Intergenic
1037805667 8:22056871-22056893 GGTGGGGGCAAGGAGGGTGGGGG + Intronic
1037839580 8:22234175-22234197 GTGGGAGGCAGGGATGGTGCTGG - Intergenic
1037918652 8:22788304-22788326 CAGGGGGACAAAGAAGGAGCAGG + Intronic
1038380249 8:27086291-27086313 GAGGAGGGAAAGGAAGGCACTGG - Intronic
1038530869 8:28317197-28317219 GAGGTGGGCAGGGAAGGGGAGGG + Exonic
1038989853 8:32856335-32856357 GAGGAGGGCAAGGAGGGTTGAGG - Intergenic
1039386244 8:37138173-37138195 GTTGGGGGAAAGGAGGGTGCAGG + Intergenic
1039792719 8:40888369-40888391 GAGGTGGGTGGGGAAGGTGCTGG - Intronic
1040055822 8:43056288-43056310 GAGAGGGGGAAGGGAGGGGCGGG + Exonic
1040816668 8:51515156-51515178 GAAGGGGGCAAGGACAGTGAGGG + Intronic
1041434930 8:57828500-57828522 GAGGAGGGGAAGGAAAGTGAGGG + Intergenic
1041579144 8:59436791-59436813 GAGGGTGGCAAAGCAGGTGAGGG - Intergenic
1042018607 8:64345093-64345115 GAGGGGAGCAATGAAGGGGATGG + Intergenic
1042056503 8:64769791-64769813 GATGGGGGGAATGAAGGTGGAGG - Intronic
1042359376 8:67865261-67865283 GAGTGGGACAAGGAGGGTTCTGG + Intergenic
1043449109 8:80349053-80349075 GAGGTGGGCAAGGAGGGAGTGGG + Intergenic
1043625996 8:82259091-82259113 GAGGGGGAATAGGAAGGTTCCGG + Intergenic
1044707828 8:95025302-95025324 GAGGGGCACGAGGAAGGCGCCGG - Intronic
1044753825 8:95441251-95441273 GGGGTGGGCAAGGAAAGAGCAGG - Intergenic
1044952862 8:97450792-97450814 CAGGTGGGCAACTAAGGTGCTGG - Intergenic
1045492043 8:102677360-102677382 GGTGGTGGAAAGGAAGGTGCTGG - Intergenic
1047874766 8:129123729-129123751 GTGGGGGGCGAGGGCGGTGCTGG - Intergenic
1048177544 8:132166429-132166451 GAGGGGGTACAGGAAGATGCTGG - Intronic
1048213855 8:132479164-132479186 GAGGGGGGAGAGGATGGTGGGGG - Intronic
1048256541 8:132909182-132909204 GAGGGGTTCAAGGTAGGAGCAGG + Intronic
1048394945 8:134005236-134005258 GTGGGGCGCAAGGAAAGTGCAGG + Intergenic
1048752492 8:137696021-137696043 GAGGGAGGCAAGGAGGTTTCTGG - Intergenic
1048754836 8:137727260-137727282 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
1049107692 8:140624039-140624061 ACGGGGAGCCAGGAAGGTGCAGG + Intronic
1049267297 8:141675279-141675301 GAGGGCGCCCAGGAAGGAGCTGG - Intergenic
1049278120 8:141730100-141730122 GGGGTGGGCAAGGCAGGAGCTGG - Intergenic
1049361143 8:142213056-142213078 GAGGGGAGACAGGAAGGTGGAGG - Intronic
1049371798 8:142271463-142271485 CTGGAGGGCAAGGGAGGTGCTGG + Intronic
1049406754 8:142455072-142455094 TAGGGGGGCAGTGAGGGTGCTGG - Intronic
1049434499 8:142580118-142580140 CAGTGGGGCAGGGTAGGTGCTGG - Intergenic
1049582676 8:143420026-143420048 GAGGGGAGCAGGGAAGGAGCAGG - Intronic
1049611033 8:143555443-143555465 GAGTTGGGCAAGGAGGATGCAGG - Intronic
1050143249 9:2538622-2538644 GAGGAGGGAAGGGAAGGTGGAGG - Intergenic
1050154359 9:2650089-2650111 GAGGTGGGGAAGGGAGGTGAGGG - Intronic
1050882866 9:10725606-10725628 GATGGGGTCAATGAAGGGGCAGG - Intergenic
1051220452 9:14843270-14843292 GAGTGGGGTAGGGAAGGTGGAGG - Intronic
1053006198 9:34606317-34606339 GAGTGGGGCAAGGAAGCTAGAGG - Intergenic
1053006750 9:34609931-34609953 GATTGGGGCAAGGAAGCTGGAGG + Intergenic
1053160287 9:35809266-35809288 GAGGGGGGCATGGAAAGGGAGGG + Intronic
1053681914 9:40491168-40491190 GAGGGGGTCATGGAAGGCCCTGG + Intergenic
1053692311 9:40592648-40592670 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1054272487 9:63044837-63044859 GAGGATGGCAAGGCAGGTCCAGG + Intergenic
1054281800 9:63133764-63133786 GAGGGGGTCATGGAAGGCCCTGG - Intergenic
1054295006 9:63326671-63326693 GAGGGGGTCATGGAAGGCCCTGG + Intergenic
1054303571 9:63393614-63393636 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1054393031 9:64631171-64631193 GAGGGGGTCATGGAAGGCCCTGG + Intergenic
1054402349 9:64720124-64720146 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1054427680 9:65136381-65136403 GAGGGGGTCATGGAAGGCCCTGG + Intergenic
1054435952 9:65204439-65204461 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1054494440 9:65817248-65817270 GAGGATGGCAAGGCAGGTCCAGG + Intergenic
1054502696 9:65885157-65885179 GAGGGGGTCATGGAAGGCCCTGG - Intronic
1054909254 9:70438842-70438864 GAGGCTGGGAAGGAAGGTTCTGG + Intergenic
1055319758 9:75071740-75071762 GAGGGCGTCAAGGAGAGTGCTGG + Intronic
1055442937 9:76354287-76354309 GAGGGGGGGATGGAAAGTTCAGG + Intronic
1055581465 9:77711106-77711128 GAGGGGGAGAAGGAAGGGGAGGG - Intergenic
1055785222 9:79863772-79863794 GAAGGCGGCCAGGAAGGTGCTGG + Intergenic
1055829137 9:80359453-80359475 GAAGGCGGCCCGGAAGGTGCTGG - Intergenic
1056610897 9:88125460-88125482 GAGGGGGGGTTGGAAGGTGGGGG + Intergenic
1056695548 9:88847272-88847294 GAGAGAGGCAAGAAAGCTGCAGG - Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057292265 9:93814261-93814283 AAGGGGGACGAGGAAGGTGGGGG - Intergenic
1057716663 9:97501548-97501570 GGGGGGGGGAAGGAGGGAGCCGG + Intronic
1057779372 9:98037079-98037101 GAAGTGGGCAAAGAAGGGGCCGG + Intergenic
1057885111 9:98823855-98823877 GATGGAGGCAAGGAGGGTGGAGG + Intronic
1057907677 9:98995001-98995023 GAGGCGGGCAGGGCAGGTGAGGG - Intronic
1058619057 9:106863947-106863969 GAAGGGGGAAAGGAAGGAGAGGG - Intronic
1059777700 9:117492499-117492521 GAGTAGGGGAAGGAGGGTGCTGG - Intergenic
1060261017 9:122073536-122073558 AAGGTGGGGAAGGAAGGAGCTGG + Intronic
1061227635 9:129289969-129289991 GAGGGGGCCAAGGGAGAAGCTGG + Intergenic
1061227811 9:129290925-129290947 GCGGGGGGCCAGTAAGGGGCGGG - Intergenic
1061368199 9:130183330-130183352 GAGGGGTGCAGGGCAGTTGCTGG + Intronic
1061399643 9:130361436-130361458 GAAGAGGGCCAGGATGGTGCTGG + Intronic
1062097825 9:134712013-134712035 GAAGGGGGGAAGGAAGGAGGGGG - Intronic
1062097877 9:134712163-134712185 GAGGGGGGAAAGGAAGAAGATGG - Intronic
1062097886 9:134712193-134712215 GAGGGGGGAAAGGAAGAAGGGGG - Intronic
1062655916 9:137604759-137604781 GCGGGGGGCGGGGCAGGTGCTGG + Intergenic
1062686624 9:137817002-137817024 GAGGGTGGCAGGGGAGGTGGCGG - Intronic
1062703971 9:137924373-137924395 GAGGGAGGGAAGGAAGGAGGAGG - Intronic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1203622978 Un_KI270749v1:138785-138807 GAGGATGGCAAGGCAGGTCCAGG - Intergenic
1203673058 Un_KI270755v1:35205-35227 GAGGTGGAGAAGGAAGGGGCTGG + Intergenic
1185608452 X:1380480-1380502 GAGGGGGGAAAGGAGGGGGAAGG + Intronic
1185942942 X:4341197-4341219 GAGTGGGGGAAGGGAAGTGCTGG - Intergenic
1186881676 X:13872787-13872809 GAGGGAGGCAAGGAATGAGAGGG + Intronic
1187230221 X:17414839-17414861 GAAGGGGGCAAGGAGGGGGAAGG - Intronic
1187529972 X:20087367-20087389 GAGGGAGGAAAGGCATGTGCTGG - Intronic
1188761174 X:34032069-34032091 TAGGGGGGAAAGGAAGGAGGGGG - Intergenic
1189740951 X:44116767-44116789 GAGAGGGGCAAGGATGGGGATGG - Intergenic
1190879634 X:54483319-54483341 TAGGGGAGCAGGGAAGGGGCTGG + Intronic
1191085552 X:56563835-56563857 CAGGCGGGCAGGGAAGGCGCGGG - Exonic
1192168592 X:68840959-68840981 AAGGGGGGCGAGGGAGGGGCAGG - Exonic
1192275855 X:69630168-69630190 GAGGGAGTCAAGGAAGGGGAGGG + Intronic
1193400555 X:81037061-81037083 GAAGGAGGGAAGGAAAGTGCTGG - Intergenic
1193655178 X:84188832-84188854 GAGAGGGACAAGTAAGGTGGGGG - Intergenic
1195697691 X:107678950-107678972 GAGGTTACCAAGGAAGGTGCTGG + Intergenic
1195786162 X:108526218-108526240 GAGGTGGAGAAGGAAGGAGCAGG + Intronic
1198519500 X:137438431-137438453 GAGGAGGACAAGGGGGGTGCGGG + Intergenic
1199798658 X:151227861-151227883 GAGGAGGGAAGGGAAGGTGGTGG + Intergenic
1200122567 X:153798042-153798064 GGGAGGTGCAAGGGAGGTGCTGG - Intronic
1200148911 X:153941976-153941998 GAGGGTGGCAAGGAACTTCCTGG - Exonic
1200210343 X:154344333-154344355 GAGGGGGGCATTGGAGGTGGGGG - Intergenic
1200220509 X:154387759-154387781 GAGGGGGGCATTGGAGGTGGGGG + Intergenic
1200225947 X:154417654-154417676 GAGTGGGGCTAGGGAGGTGAGGG - Intronic
1200293567 X:154894720-154894742 GAGGGGGGGTAGGAAGGTGGGGG - Intronic
1201147555 Y:11073187-11073209 GCGGGGGGCATGGGAGGGGCAGG - Intergenic