ID: 936531881

View in Genome Browser
Species Human (GRCh38)
Location 2:113282258-113282280
Sequence CAATTCATCCTGATTTGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936531881_936531885 3 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531885 2:113282284-113282306 ATCCTAGCTGATTAGAGTGTGGG No data
936531881_936531887 8 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531887 2:113282289-113282311 AGCTGATTAGAGTGTGGGAGTGG No data
936531881_936531891 19 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531891 2:113282300-113282322 GTGTGGGAGTGGGATGGTTTGGG No data
936531881_936531893 21 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531893 2:113282302-113282324 GTGGGAGTGGGATGGTTTGGGGG No data
936531881_936531892 20 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531892 2:113282301-113282323 TGTGGGAGTGGGATGGTTTGGGG No data
936531881_936531888 9 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531888 2:113282290-113282312 GCTGATTAGAGTGTGGGAGTGGG No data
936531881_936531889 13 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531889 2:113282294-113282316 ATTAGAGTGTGGGAGTGGGATGG No data
936531881_936531890 18 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531890 2:113282299-113282321 AGTGTGGGAGTGGGATGGTTTGG No data
936531881_936531884 2 Left 936531881 2:113282258-113282280 CCCGGGCAAATCAGGATGAATTG No data
Right 936531884 2:113282283-113282305 CATCCTAGCTGATTAGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936531881 Original CRISPR CAATTCATCCTGATTTGCCC GGG (reversed) Intergenic
No off target data available for this crispr