ID: 936532335

View in Genome Browser
Species Human (GRCh38)
Location 2:113284858-113284880
Sequence TAGGGTAGTGAAGAGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936532335_936532337 -7 Left 936532335 2:113284858-113284880 CCAGCATTCTCTTCACTACCCTA No data
Right 936532337 2:113284874-113284896 TACCCTATGGAGTAGCTCCAAGG No data
936532335_936532342 19 Left 936532335 2:113284858-113284880 CCAGCATTCTCTTCACTACCCTA No data
Right 936532342 2:113284900-113284922 GGACAACTGTAATAACTCCAAGG No data
936532335_936532340 -2 Left 936532335 2:113284858-113284880 CCAGCATTCTCTTCACTACCCTA No data
Right 936532340 2:113284879-113284901 TATGGAGTAGCTCCAAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936532335 Original CRISPR TAGGGTAGTGAAGAGAATGC TGG (reversed) Intergenic
No off target data available for this crispr