ID: 936532606

View in Genome Browser
Species Human (GRCh38)
Location 2:113287174-113287196
Sequence TAATGTGGCTGGAGTGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936532602_936532606 4 Left 936532602 2:113287147-113287169 CCTGGTAGGGAGGTGTGCTTCAT No data
Right 936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG No data
936532597_936532606 27 Left 936532597 2:113287124-113287146 CCTCATGGAACAAATAAACAGAT No data
Right 936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936532606 Original CRISPR TAATGTGGCTGGAGTGTAGA GGG Intergenic
No off target data available for this crispr