ID: 936535989

View in Genome Browser
Species Human (GRCh38)
Location 2:113311650-113311672
Sequence TCTCTTCTGTTGGGGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936535989_936535999 -6 Left 936535989 2:113311650-113311672 CCCCTGGCCCCCAACAGAAGAGA No data
Right 936535999 2:113311667-113311689 AAGAGAAGGGTGGAGCTAGCAGG No data
936535989_936536000 -2 Left 936535989 2:113311650-113311672 CCCCTGGCCCCCAACAGAAGAGA No data
Right 936536000 2:113311671-113311693 GAAGGGTGGAGCTAGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936535989 Original CRISPR TCTCTTCTGTTGGGGGCCAG GGG (reversed) Intergenic