ID: 936538677

View in Genome Browser
Species Human (GRCh38)
Location 2:113332533-113332555
Sequence CAGCCTGAGCAGAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 9, 3: 40, 4: 461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936538677_936538678 -8 Left 936538677 2:113332533-113332555 CCATCATCACTCTGCTCAGGCTG 0: 1
1: 0
2: 9
3: 40
4: 461
Right 936538678 2:113332548-113332570 TCAGGCTGCCCCTTGAAGTGTGG 0: 1
1: 0
2: 0
3: 16
4: 156
936538677_936538682 11 Left 936538677 2:113332533-113332555 CCATCATCACTCTGCTCAGGCTG 0: 1
1: 0
2: 9
3: 40
4: 461
Right 936538682 2:113332567-113332589 GTGGCCACCACCACTTTCTCTGG 0: 2
1: 0
2: 1
3: 14
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936538677 Original CRISPR CAGCCTGAGCAGAGTGATGA TGG (reversed) Intergenic
900144821 1:1153594-1153616 CAGCCTCAGCTGGGTGATGGAGG - Intergenic
901226066 1:7613703-7613725 CAGCCTGAGGAGAGCGATGGCGG + Intronic
901335335 1:8444193-8444215 CAGCCTGGGCAAACTGATGAGGG - Intronic
901800728 1:11706547-11706569 CTGCCTGAGCAGAGTCCTGCAGG + Exonic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902051966 1:13570892-13570914 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
903161075 1:21489555-21489577 CAGCCTCAGCAGAGTGTCGTGGG - Intergenic
903713947 1:25348999-25349021 GATCCTGAGCAGGGTGAGGAGGG + Intronic
904547403 1:31286482-31286504 GAGCCGTAGCAGAGTGATGAGGG - Intronic
904663088 1:32099648-32099670 CAGCATGAGCTGTGTGGTGAGGG + Intronic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904910795 1:33932685-33932707 CAGCCAGAGATAAGTGATGAGGG - Intronic
905265932 1:36754397-36754419 AAAGCTGAGCAGAGAGATGAAGG - Intergenic
905329154 1:37180031-37180053 GTGGCTGAGCAGAGTGATGGAGG - Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905799074 1:40831989-40832011 CAGCCTGGGCTGGGTGAAGAGGG - Intronic
905811294 1:40915357-40915379 CTTCCTGGGCAGAGTGATGCAGG + Intergenic
906667181 1:47630277-47630299 CAACATGAGCAGAGACATGAAGG + Intergenic
907088342 1:51700303-51700325 GAGCCTGAGTAGGGTGAAGAGGG - Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907978300 1:59455296-59455318 CAATCTGAGCTGAGTCATGAAGG + Intronic
908168028 1:61477271-61477293 CAGCCTGAGCAGGGTGATGTAGG + Intergenic
908289359 1:62646748-62646770 CAGCCTGAGCAGACTGATACAGG + Intronic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
910808094 1:91208507-91208529 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910852974 1:91666627-91666649 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
912816005 1:112829222-112829244 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
912941079 1:114045407-114045429 GAGCTTGAGTAAAGTGATGAAGG + Intergenic
912980431 1:114366134-114366156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
914485300 1:148103893-148103915 CAGGCTCAGCAGCGTGCTGATGG - Exonic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915169778 1:153969509-153969531 CAGACAGAGCAAAGGGATGAGGG + Intronic
917311775 1:173686115-173686137 CAGCCTGAGGAGAGTCAGGAGGG + Intergenic
918984980 1:191613884-191613906 CAGCGAGGTCAGAGTGATGATGG + Intergenic
919135924 1:193507814-193507836 GAGCCTGAGCAGAGACAAGAGGG - Intergenic
920258176 1:204670799-204670821 CTGCTTCAGCAGAGTGATGGGGG + Intronic
920850499 1:209625077-209625099 CAGCCTGAGAAGAATGAAAATGG - Intronic
920910236 1:210209735-210209757 CAGTCTAGGGAGAGTGATGAAGG - Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921074624 1:211690402-211690424 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
922099740 1:222470777-222470799 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
922261775 1:223950269-223950291 GAGCCTGAGCAGATTGAGGTGGG - Intergenic
922542160 1:226427784-226427806 CAGCCTGAGCTGAGTTTTAAAGG - Intergenic
922573826 1:226648965-226648987 CAGCCTGAGCAAAATGCTCAGGG + Intronic
922735305 1:227975473-227975495 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
922826927 1:228528143-228528165 CAGCCTGGGCACAGTGGTGCTGG + Intergenic
923125237 1:231028753-231028775 AAGCCTGAGCAGAGAGCGGAAGG - Intronic
923332451 1:232937879-232937901 CAGCCAGAGCAGAGAGACAAAGG - Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924091528 1:240506873-240506895 GAGCCTGAGCTAAGTGGTGATGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1063391496 10:5652646-5652668 CAGCCTGAGCAAATTGATGATGG - Intronic
1064724180 10:18260714-18260736 CAGCCTGTGCATTGTGAAGAAGG + Intronic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066503752 10:36020739-36020761 CAGCCGGGGCAGAGTCATTAAGG + Intergenic
1066509500 10:36080744-36080766 CAGCCAAAGCAGTGTTATGAGGG - Intergenic
1066620910 10:37348888-37348910 CTACCTGAGCAGAGTGACAAGGG + Intronic
1066733543 10:38453108-38453130 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1067155064 10:43774587-43774609 CACACTGAGCACAATGATGATGG + Intergenic
1067169603 10:43895816-43895838 AAGCATGAGCAGAGGGATAAGGG + Intergenic
1068671813 10:59730648-59730670 CAGTCTGAGGAGAGTCATGAGGG + Intronic
1068675816 10:59768215-59768237 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1072334787 10:94388416-94388438 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1073919495 10:108442858-108442880 CAGCCTGAGCCAAGTGGTAAAGG + Intergenic
1073956502 10:108877577-108877599 CAGCCTGTTCAGAGAGATAAAGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1075963248 10:126587282-126587304 CAGCCTGAGCTGACTGATACAGG - Intronic
1076123992 10:127960487-127960509 CTGCCAGAGCTGAGTGCTGAGGG - Intronic
1076649084 10:131975214-131975236 CAGCCAGCGCAGAGTGAGGCGGG - Intronic
1076768852 10:132651976-132651998 CATCCTGAGCACAGGGGTGAGGG - Intronic
1077159657 11:1106961-1106983 CACCCTGAGCAGAGTGCTGAGGG - Intergenic
1077414777 11:2420011-2420033 CTGTCTGGGCAGAGTGGTGAAGG - Intronic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1078435788 11:11324220-11324242 CAACCTGAGCAGACTAATGCAGG + Intronic
1078512367 11:11994940-11994962 CAGACTGAGGACAGTGATCATGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081539974 11:44027260-44027282 CAGCCAGAGGAGAGAGATGTGGG + Intergenic
1081883616 11:46475731-46475753 TATCCAGAGCAAAGTGATGATGG - Intronic
1083089876 11:60189000-60189022 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1084499203 11:69525012-69525034 CACCCTGCGCGGTGTGATGAGGG + Intergenic
1084613022 11:70216050-70216072 CAGCTGGATCAGAGAGATGAAGG + Intergenic
1084974208 11:72787712-72787734 CAGCCTGAGCACAGAGCTGAAGG - Intronic
1085239770 11:75043624-75043646 TAGTCTGAGCAGAGTCAGGAGGG - Intergenic
1086973476 11:93107689-93107711 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1087684501 11:101248109-101248131 CAGTCTGAGTAGAGTCAGGAGGG - Intergenic
1087894792 11:103575606-103575628 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1088861743 11:113806655-113806677 CAGGCTGAACAGAGTGCTAAAGG + Intronic
1090035163 11:123243365-123243387 CAGCCTGCGCTGAGTACTGAAGG + Intergenic
1090730478 11:129569379-129569401 GAGCCTGAGCAGGGTAAGGAGGG + Intergenic
1091360886 11:134977782-134977804 CAGCCTCAGCGGAGTGAGCAGGG - Intergenic
1091814531 12:3426525-3426547 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1092016895 12:5167093-5167115 CAGCCTGGACAGAGTGCTTAGGG + Intergenic
1092070073 12:5624950-5624972 CAGCCTGGGCAAAGTCTTGATGG + Intronic
1092214426 12:6671019-6671041 CAGCTTGAGCTGAGTGATGCAGG - Intronic
1092933704 12:13340464-13340486 CAGCTTGAGCTGTGTGATGGTGG - Intergenic
1093351501 12:18108283-18108305 CAGCTTGAGCAAAATCATGAAGG + Intronic
1093594130 12:20941218-20941240 CAGTCTGAGAAGAGTCAGGAGGG + Intergenic
1093757162 12:22865713-22865735 CAGCGTGAGCAGGGTTAGGAGGG - Intergenic
1094773889 12:33698952-33698974 CTTCATGACCAGAGTGATGAAGG + Intergenic
1095359512 12:41319468-41319490 CAGTTTGTGCAGAATGATGAGGG - Intronic
1096452512 12:51756186-51756208 CAGCATGAGCAGGGTGACGAGGG - Intronic
1096614977 12:52827087-52827109 CAGCCTGTGCAGTGTCATGGAGG - Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097046678 12:56191851-56191873 CAGCCTGAGCAGTGGTATGAAGG - Intergenic
1097860328 12:64512415-64512437 CAGCCTGAGCAACATGGTGAGGG + Intergenic
1098248377 12:68543781-68543803 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099943266 12:89215711-89215733 CAGCATGAACAGAGAGTTGACGG + Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101184298 12:102257548-102257570 AAGCATGAGCATAGTGATGCTGG + Intergenic
1101203464 12:102461262-102461284 CAGCCTGAGCCCATTAATGAAGG - Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1107131849 13:36904991-36905013 TAGCCTGAGCTGAGTTCTGATGG - Intronic
1107743126 13:43475297-43475319 CAGCCTAAGCAGTGTGGAGATGG + Intronic
1107915494 13:45145836-45145858 AAGCCTGAACAGGGTGAGGAGGG - Intronic
1108434721 13:50390371-50390393 CAGTCTGGCAAGAGTGATGAAGG - Intronic
1108439460 13:50435833-50435855 AAGCTTGATCAGAGTGAAGAAGG + Intronic
1108533505 13:51348373-51348395 CAGCCTGAGGAGAGCCAGGATGG + Exonic
1108584605 13:51859379-51859401 CAGCCTGAGGTGAGAGATTATGG - Intergenic
1108714451 13:53065052-53065074 CAGCCAAAGCAAAATGATGATGG + Intergenic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1109909515 13:68891066-68891088 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1111984778 13:95054795-95054817 AAGCCTGAGAAGAGAGATAAAGG + Intronic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1113611135 13:111645724-111645746 CAGGCTGAGCAGGGGGCTGATGG + Intronic
1114236106 14:20825016-20825038 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1114253593 14:20982616-20982638 CCACCTGAGCAGGGTCATGAGGG - Intergenic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1117836771 14:59815929-59815951 CACCCTGAGCAAAGGCATGAAGG - Intronic
1119181109 14:72605829-72605851 GAGGTTGTGCAGAGTGATGATGG - Intergenic
1120169426 14:81234143-81234165 CAGCCTGACCAACATGATGATGG - Intergenic
1121108397 14:91295716-91295738 CAGCATAAGCGAAGTGATGAGGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122660683 14:103293009-103293031 CAGTCTGAGGACAGAGATGAGGG + Intergenic
1123088927 14:105733183-105733205 CAGCGTGAACAGGGTGATGATGG - Intergenic
1125421422 15:39508545-39508567 CTCCCTGAGCAATGTGATGATGG - Intergenic
1126105660 15:45145357-45145379 CAGGCTGAGATGAGTGAGGATGG - Intronic
1127300709 15:57650983-57651005 AATTATGAGCAGAGTGATGAAGG - Intronic
1128064447 15:64755685-64755707 CAGCCACACCAGAGTGAGGAGGG + Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1131838654 15:96414745-96414767 CACCCTGAGGAGTGTGAGGAGGG + Intergenic
1132046173 15:98564493-98564515 CAGCCTGAGCTGAGGCATCAGGG + Intergenic
1134138431 16:11696206-11696228 GACCCTGAGCAGAGACATGAGGG - Intronic
1134794585 16:17023395-17023417 CAGCTTGAGCAGATTTCTGAGGG - Intergenic
1134859875 16:17551650-17551672 CAGCCTGAGCACTGTGATGCTGG + Intergenic
1135073136 16:19369912-19369934 CAGCCTCAGCCAGGTGATGAAGG + Intergenic
1135241497 16:20810801-20810823 GAGCCTAAGCAGAGTCAAGAGGG - Intronic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138119888 16:54391555-54391577 CAGCATGAGGAGAGTGATTAAGG + Intergenic
1138586365 16:57972848-57972870 CAGCCTGACGGGAGGGATGATGG + Intergenic
1138868142 16:60848889-60848911 CAGACAGAGAAGAGTGATTACGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140467316 16:75192867-75192889 CAACCTGTGCAAAGTGAGGAAGG - Intergenic
1141451813 16:84108692-84108714 GAGTCTGAGCGGAGTGAGGAAGG + Intronic
1143049023 17:4107438-4107460 GAGCCTGAGCAGGGTGAGAAAGG + Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144395670 17:14840569-14840591 CAGCCTGAACAGACTAAGGAAGG + Intergenic
1145250019 17:21292146-21292168 CAGCCTGAGCAGCCTGCTGCGGG + Intronic
1145771004 17:27493071-27493093 CATCATCAGCAGAATGATGAAGG - Intronic
1145978889 17:28999821-28999843 GGGCCAGAGCAGAGTGATGTGGG - Intronic
1146055356 17:29578117-29578139 CAGGCTGGGTAGAGTGCTGAGGG - Intronic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146605095 17:34251166-34251188 TGGCCTGAGCAGTGTGATGAGGG - Intergenic
1146764143 17:35504179-35504201 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1147250310 17:39149331-39149353 CAGCCTGACCTGATTGATGGCGG - Intronic
1147487893 17:40836015-40836037 CAGCCTCAACACAGTGATAAAGG + Exonic
1147810324 17:43164376-43164398 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1148006694 17:44437499-44437521 CAGCCTGAGTGAAATGATGAGGG - Intronic
1148287647 17:46409994-46410016 CAGCCTGAGTAAAATGATAAGGG - Intergenic
1148309816 17:46627574-46627596 CAGCCTGAGTAAAATGATAAGGG - Intronic
1148790248 17:50168700-50168722 TAGCCAGAGGAGAGTGGTGAGGG - Intronic
1148991986 17:51674004-51674026 AAGCCTGAGCAGGGTTTTGAAGG - Intronic
1151528766 17:74690504-74690526 CTGCCTTAGCAAAGTCATGATGG + Intronic
1151676472 17:75601393-75601415 CAGCCTGTGCAGAGGCGTGAAGG + Intergenic
1152454930 17:80409319-80409341 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1153652806 18:7256301-7256323 CAGCCTGAGCTGACTTCTGATGG + Intergenic
1153830371 18:8917220-8917242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1154014151 18:10601575-10601597 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1154357743 18:13634987-13635009 CAGCCTTTTCAGAGTGGTGATGG + Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155354083 18:24934854-24934876 GAACCTGGCCAGAGTGATGATGG - Intergenic
1155936986 18:31764330-31764352 CAGCCTGAGAAGGGTGACAATGG - Intergenic
1156267754 18:35503749-35503771 CACACTGAGCAGAGTGAATAGGG - Intergenic
1156645926 18:39162298-39162320 CAGCCTGAGGAAGGTGATGCAGG + Intergenic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1159381782 18:67669155-67669177 CAGCCTGAGCAGAATAATACAGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1161860530 19:6794825-6794847 CAGACAGGGCATAGTGATGATGG + Intronic
1162281882 19:9705356-9705378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1163737462 19:18990260-18990282 CTGCCTGACCAGGGTGAGGAGGG - Intergenic
1163991832 19:21006199-21006221 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1164121585 19:22270033-22270055 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164130739 19:22358964-22358986 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164216972 19:23159055-23159077 CAGACTGAGGAGAGTCAGGAGGG + Intergenic
1165320766 19:35083885-35083907 CAGCCACGGCAGAGTGATCAGGG + Intergenic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166346761 19:42171136-42171158 CAGCCTGAGCAGTGTGCTGAGGG - Intronic
1166405079 19:42514618-42514640 CAGCCTGAGTTGACTGGTGAGGG - Intronic
1166414526 19:42584277-42584299 CAGCCTGAGTTGACTGGTGAGGG - Intronic
1167804181 19:51768314-51768336 CAGCCTCAGCATTGTGAGGAAGG - Intronic
1167889590 19:52528665-52528687 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167894672 19:52571274-52571296 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167898741 19:52602198-52602220 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167903156 19:52637361-52637383 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167904552 19:52647982-52648004 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167909330 19:52689465-52689487 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167913841 19:52724758-52724780 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167921345 19:52785754-52785776 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167925852 19:52820612-52820634 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167930038 19:52856601-52856623 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167934173 19:52892833-52892855 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167937849 19:52922390-52922412 CAGACAGAGCAGAGTGGTGCTGG - Intergenic
1167940348 19:52941656-52941678 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167946366 19:52992323-52992345 CAGACAGAGCAGAGTGGTGCTGG - Intergenic
1167991825 19:53366703-53366725 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167995217 19:53396153-53396175 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167999475 19:53432949-53432971 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1168003847 19:53469710-53469732 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
925043870 2:755930-755952 CATCCTCAGCAGAGGGATCAGGG + Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926168391 2:10535762-10535784 AAGCCTGGGCAGAGTGCGGAGGG + Intergenic
926491474 2:13530134-13530156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
926547558 2:14260634-14260656 CAGCTTGAGGAAAGGGATGAGGG + Intergenic
926550871 2:14299529-14299551 CTGCCTTAGCAGAGGTATGAGGG - Intergenic
927922766 2:26986190-26986212 CAGTCAGAGAACAGTGATGATGG - Intronic
929279766 2:40065103-40065125 CAACCTGAGAAGAATGATGCCGG - Intergenic
929376391 2:41291226-41291248 CAGCCTGCCCAGACTTATGATGG - Intergenic
930517611 2:52428301-52428323 CAGACAGAGCAAAGTGAGGAGGG - Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933819291 2:86095086-86095108 CAGCCAGAGCAGAGTGAGAGGGG - Intronic
934032218 2:88058569-88058591 CAGCATGTGCAGAGACATGAAGG - Intergenic
934605224 2:95689995-95690017 GCGCCTGAGCAGAGTGATGATGG - Intergenic
934869973 2:97854710-97854732 CAGCCAGACCAGAGTGAGCATGG - Intronic
935048394 2:99502485-99502507 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
935842821 2:107131920-107131942 CAGCCTCAGCAGAGTGATAGTGG - Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937297738 2:120819919-120819941 CAGCCTGAGCTGGGTCTTGAGGG + Intronic
937797550 2:126041758-126041780 CAGGCAGTGCAGAGTGCTGAGGG + Intergenic
938703145 2:133897329-133897351 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
939102094 2:137907094-137907116 GAGCCAGAGTAGAGTGAAGAGGG - Intergenic
939215850 2:139237232-139237254 CACACAGAGCAGGGTGATGAAGG + Intergenic
939923067 2:148140964-148140986 CAGCCTGGGCAACATGATGATGG - Intronic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
940470400 2:154090549-154090571 CAGACTGAGAAAAGTGCTGAAGG - Intronic
942248319 2:174026774-174026796 CAGCCAGAGCAGAGTGACTAAGG - Intergenic
943408071 2:187513942-187513964 CAGTCTGAGGAGAGTCAGGAAGG - Intronic
944436483 2:199695767-199695789 CAGCCTGTGCAGAGTGCAGAAGG + Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944634106 2:201657832-201657854 GAGCATGAGCAGGGTGAAGAAGG - Intronic
944657447 2:201890306-201890328 CAGCATGAGCAAAGATATGAAGG - Intronic
944988959 2:205212490-205212512 CAGCCAGAGTAGGGTGAGGAAGG + Intronic
945289724 2:208115356-208115378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
945720272 2:213410380-213410402 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
946930793 2:224668542-224668564 CAGCCTGAACAAAGTAATTATGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947378591 2:229523069-229523091 CATCCTGAGAAAGGTGATGAGGG + Intronic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
948533873 2:238631947-238631969 AAGCCTGGGCATTGTGATGACGG + Intergenic
1169150098 20:3282818-3282840 CCGCCTGAGCAGAGACCTGAAGG - Intronic
1170254031 20:14319593-14319615 CAGCGTCTGCAGAGTAATGAGGG - Intronic
1170257082 20:14356872-14356894 CAGCCAGAGCTGTGTGATGGGGG + Intronic
1173040179 20:39454603-39454625 CAGCATTAGCAGAGTCCTGAAGG - Intergenic
1173762823 20:45579038-45579060 GAGCCTAAGCAGGGTGAAGAGGG - Intronic
1174919210 20:54683670-54683692 AAACCTGAGCAGAGAGCTGAGGG + Intergenic
1175057517 20:56211669-56211691 CAGCCCTAGCAGAGTAATGCAGG + Intergenic
1175513892 20:59555753-59555775 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1179670902 21:42946931-42946953 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1179766794 21:43580047-43580069 AGGCCTGAGCAGAGGGATGTAGG - Intronic
1181458635 22:23073376-23073398 CGGCCTGGGCAGAATGAAGAGGG + Intronic
1182408159 22:30156130-30156152 GAGCCTGTGCAGTGTGAGGAGGG - Intronic
1182691128 22:32164230-32164252 CACCCTGAGCACAGAGATGCAGG + Intergenic
1183997759 22:41648330-41648352 CAGCATGTACTGAGTGATGAAGG - Intronic
1184284398 22:43460812-43460834 CATTCTGAGGTGAGTGATGAGGG + Intronic
1184490708 22:44807192-44807214 CAACCTGAGCTGAGGGATCATGG + Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
949479151 3:4476984-4477006 CAGCCTGCACCTAGTGATGATGG - Intergenic
949654738 3:6205048-6205070 CATCCTGAGCAGCTTTATGATGG + Intergenic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
950887725 3:16375635-16375657 CAGCCTGAGCAGAGAGATAAAGG + Intronic
951248570 3:20368156-20368178 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
951250606 3:20390135-20390157 GTGCCTGAGCAGAATGATTAAGG + Intergenic
952113250 3:30148937-30148959 TAGCCTGAGCAGGGTGAGGAGGG + Intergenic
952269351 3:31817038-31817060 CAGCCAGAGCAGGGAGAGGATGG - Intronic
952522735 3:34178383-34178405 CAGCTTTGGCAGAGTGAAGAAGG + Intergenic
953229825 3:41054895-41054917 CAGCCTGTGGAGAGACATGAAGG + Intergenic
953521544 3:43647956-43647978 CAGCCAAAGTAGAGAGATGAGGG - Intronic
954604723 3:51900530-51900552 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
955072645 3:55584669-55584691 CAGCCTCAGCAGGGAGATGTGGG - Intronic
955472122 3:59296754-59296776 CAGCCAAAGCAGTGTGAAGAGGG + Intergenic
957999938 3:87737748-87737770 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
958747789 3:98158316-98158338 GATACTGAGCAGAGTGTTGAAGG - Intergenic
958753086 3:98216084-98216106 GATACTGAGCAGAGTGTTGAAGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960060532 3:113316287-113316309 CAGCCAAAGCAGAGTTAAGAGGG + Intronic
960720372 3:120619286-120619308 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
962001792 3:131305606-131305628 CAGCCTGTGCAGAGCCAAGAGGG - Intronic
962097360 3:132306220-132306242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
962277050 3:134023441-134023463 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
964307766 3:155359100-155359122 CAGCCCAAGCAGAGTAATGTAGG + Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
964933033 3:162048700-162048722 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
966218399 3:177526414-177526436 CAGCCTGGGCACAGTTTTGATGG + Intergenic
967821628 3:193844159-193844181 CAGCCAGAGCCAAGTGATAAAGG + Intergenic
967826447 3:193881509-193881531 CTACCTGAGCAGAGAGAGGAAGG - Intergenic
967856009 3:194118080-194118102 CAGTCTGAGAAGGGAGATGAGGG - Intergenic
968096052 3:195931576-195931598 GAGGCAGAGCACAGTGATGATGG + Intergenic
968247404 3:197166211-197166233 GAGCCTGAGCAGCGTGAGAAGGG + Intronic
968464146 4:742117-742139 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464167 4:742181-742203 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464187 4:742241-742263 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969711383 4:8846282-8846304 CAGCCTGTGCAGTGTGGAGAGGG - Intronic
970606166 4:17683879-17683901 CAGCCTGGACAGCATGATGAAGG + Intronic
972276511 4:37563189-37563211 TAGCCTTAGCAGAGTGATATAGG - Intronic
972356072 4:38280479-38280501 AAGCCTGAGCAGGGTTTTGAGGG - Intergenic
972784969 4:42318309-42318331 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
973941402 4:55914687-55914709 AATCTTGAGCAGAGTGATGCTGG + Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
976221422 4:82759511-82759533 GATCCTGAGCAGAGTGTTGAGGG - Intronic
976911454 4:90312234-90312256 TGGCATGAGCAGAGTGATGGAGG + Intronic
977043586 4:92042582-92042604 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
977312343 4:95403287-95403309 CAGCCTGAGCAAACTCATGTTGG + Intronic
977972361 4:103227261-103227283 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
979063393 4:116097083-116097105 CAACCTGGGCAGTGTGAAGATGG - Intergenic
979259892 4:118636095-118636117 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
979328492 4:119404530-119404552 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
979456160 4:120927991-120928013 CATCCTGAGCACACTGATGTAGG - Intergenic
980438811 4:132814914-132814936 CAGTCTGAGGAGAGTCAGGATGG + Intergenic
980993827 4:139761900-139761922 CAACATGAGCAAAGTAATGAAGG + Intronic
981554361 4:145976903-145976925 GAGACTGAGCAGGGTGAGGAGGG + Intergenic
982219624 4:153113424-153113446 CAGTCTGAGCTGAGTAAGGAGGG - Intergenic
983708420 4:170686649-170686671 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
983897953 4:173102063-173102085 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
984493150 4:180461450-180461472 CAAACTGAGAAGTGTGATGATGG - Intergenic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985260644 4:188111959-188111981 CAGCCTGGGGCGAGTGGTGAAGG - Intergenic
987278217 5:16385092-16385114 CAGCATGAGAAAAGTTATGAAGG + Intergenic
988262765 5:28910116-28910138 CAACCTCAGCAGCGTGATGGAGG - Intergenic
989343928 5:40408105-40408127 CAGACTGGGCAGGGTTATGAGGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
991306063 5:65177450-65177472 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
992481580 5:77157029-77157051 CAGCTTCAGCAGGGTGATCATGG + Intergenic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
994659364 5:102635212-102635234 CAGCCTGGGCAGCATGGTGAAGG + Intergenic
995867408 5:116706532-116706554 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
997146827 5:131443410-131443432 GACCCTCAGCAGAGTGATGATGG - Intronic
997339286 5:133130197-133130219 CACCCTGATCAGTATGATGAAGG + Intergenic
998956214 5:147441176-147441198 CAGCCCTAGCAGAGTCATAAAGG - Intronic
999732699 5:154486712-154486734 GAGCCTGGGGAGAGTGGTGAGGG - Intergenic
1000236810 5:159369685-159369707 CAGTCTGAGGAGAGTCAGGAAGG - Intergenic
1002542070 5:179913040-179913062 CAGCCTGAGGAGAGCAAAGATGG + Intronic
1002999132 6:2314572-2314594 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1003181658 6:3797323-3797345 TAGCCTGAAGTGAGTGATGATGG - Intergenic
1005047021 6:21652525-21652547 CAGCCTAAGCAGACTAATGCAGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005461922 6:26077563-26077585 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1006073729 6:31516028-31516050 CAGCCAGGTCAGAGTGATGTTGG - Intergenic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006935432 6:37713898-37713920 TTGCCTGAGCTGAGTCATGAGGG - Intergenic
1007680360 6:43629250-43629272 CGGCCTGAGCAGAGTGGGGTGGG + Intergenic
1008043360 6:46826445-46826467 CAGCCTGAGCACTGTCCTGATGG - Exonic
1008123454 6:47643992-47644014 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1008547477 6:52595993-52596015 CAGCCTGAACAGAGAGTTGGGGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1011022032 6:82825212-82825234 GAGCCAGAGCTGGGTGATGAGGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011949012 6:92940983-92941005 AAGTCTGAGCAGCCTGATGAAGG - Intergenic
1014318303 6:119894225-119894247 CAGCCTAAGCAGAGTAATACAGG - Intergenic
1014329737 6:120047708-120047730 GAGCCTTAGAAAAGTGATGAGGG - Intergenic
1016387807 6:143545367-143545389 CAGCCTGAGGCTAGTGGTGATGG + Intronic
1017112304 6:150943807-150943829 CAGAATGAGTAGAGTCATGAGGG + Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1019070519 6:169341223-169341245 CAGCCAGAGCCCAGTGAGGAGGG + Intergenic
1020043911 7:5025353-5025375 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1020254930 7:6497728-6497750 CGGCCTGAGCAGGGAGATGGAGG - Intronic
1020655767 7:10926717-10926739 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1020745414 7:12073084-12073106 CAGCCTGAGGGGAGTCAAGAAGG - Intergenic
1021444684 7:20719660-20719682 GAGCCAGAGCAGGGTGAGGAGGG + Intronic
1021906392 7:25338478-25338500 CAGCCTGAGCAGGGGAATGGGGG + Intergenic
1022438234 7:30410402-30410424 CAGTCTGAGTAGAGTGGTCAGGG - Intronic
1023401611 7:39795719-39795741 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1023799091 7:43817976-43817998 CAGTCTGAGGAGAGTAAGGAGGG - Intergenic
1023863808 7:44229463-44229485 CATCCTGAGCTCAGTGAGGAGGG - Exonic
1024075592 7:45816341-45816363 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1024098687 7:46006899-46006921 CAGCCTGAGCAGACTGATACAGG + Intergenic
1024605948 7:51022702-51022724 CATCTTGTGCAGAGTCATGAAGG - Intronic
1024648007 7:51384956-51384978 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1024812927 7:53234896-53234918 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1025051861 7:55739452-55739474 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025128819 7:56365120-56365142 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025177200 7:56808001-56808023 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025261561 7:57423451-57423473 CTACCTGAGCAGGGTGATGAGGG - Intergenic
1025694592 7:63768385-63768407 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1026353089 7:69534537-69534559 CCGGCTGAGCAGGGTGCTGAAGG + Intergenic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1028133817 7:87206346-87206368 AAGACTGAGCAAAGTGATGTGGG - Intronic
1028333967 7:89628680-89628702 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1029176239 7:98666571-98666593 CACCCTCTGAAGAGTGATGAAGG + Intergenic
1029436929 7:100568764-100568786 CAGCCTGAGCAGGGTGGGCAGGG - Intergenic
1029822051 7:103156073-103156095 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1030450995 7:109710818-109710840 CAGCCTGAGCAGGGTAGGGAGGG - Intergenic
1030684470 7:112470386-112470408 CAGCTTCAGTGGAGTGATGAGGG + Intronic
1032170537 7:129581046-129581068 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034953637 7:155318163-155318185 CATCCTGATAATAGTGATGATGG - Intergenic
1035125588 7:156606676-156606698 CTGCCGGAGCCGAGAGATGAGGG - Intergenic
1035242299 7:157540087-157540109 CAGCCCAAGCAGAGTGATTCAGG - Exonic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1036774229 8:11599068-11599090 CAGCCTGAGCTGATTAATGCAGG + Intergenic
1037767934 8:21783226-21783248 CAGCCTCAGCAGAGAGCTGGGGG + Intronic
1038084071 8:24174188-24174210 CAGCCTGGGCAGAGTGTCAACGG + Intergenic
1038089650 8:24239134-24239156 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1039083303 8:33755415-33755437 CAGCCTCTGCAGAGTCATGCAGG + Intergenic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1040635868 8:49272062-49272084 CAGCCAAAGCAGAGTTAAGAGGG - Intergenic
1040889472 8:52301996-52302018 GAGCCAGAGCAGAGTGAAGATGG + Intronic
1041157360 8:55002204-55002226 CAGCCAGAGGAGAGTCATGTAGG - Intergenic
1041515449 8:58694667-58694689 CAGTCTGAGAAGAGTCAGGAGGG - Intergenic
1043339292 8:79218179-79218201 GAGCTAGAGCAAAGTGATGATGG + Intergenic
1045775506 8:105797742-105797764 CAGCCTGAGCTGAGGTATGAAGG - Intronic
1047429182 8:124776030-124776052 CAGCCTGCAGAGAGTCATGAAGG - Intergenic
1048176178 8:132154608-132154630 CAGCCTGTGCAATGGGATGATGG + Intronic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048577362 8:135703635-135703657 CAGCCTGAGCAGACTAATACAGG + Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049299136 8:141860615-141860637 CACCCTGAGCAGAGCCATCAGGG + Intergenic
1049420371 8:142513785-142513807 CAGCCATTGCAGAGTGAGGAAGG + Intronic
1050577434 9:7011848-7011870 CGGCATGAGCAGAGTGCAGATGG - Exonic
1052508073 9:29380709-29380731 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1052834705 9:33241721-33241743 CTGCCTGGGCTGAGTGAGGAGGG + Intronic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1053909110 9:42877449-42877471 CAGCCTGGGCAGTTTAATGAGGG + Intergenic
1055968005 9:81884041-81884063 CAGCCTGAGCCAAGTGAGGAAGG - Intergenic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1056414437 9:86362616-86362638 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1058152346 9:101476757-101476779 CTGCCTGTCCACAGTGATGATGG + Exonic
1060265844 9:122111068-122111090 CAGCCTGGGCAAGGGGATGAGGG + Intergenic
1060881174 9:127119201-127119223 GAGCCTCAGCACAGTTATGAGGG - Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061456354 9:130700848-130700870 CAGCCTGGCCAGGGTGATGAAGG - Exonic
1061590316 9:131593743-131593765 GAGCCTGAGCACAGTGCGGATGG - Intronic
1062034409 9:134376491-134376513 CTGCCTGAGCAGAGTGTGGCGGG - Intronic
1185570856 X:1133827-1133849 CAGCCTCACCAGAGTGGGGAGGG - Intergenic
1185616558 X:1425433-1425455 GAGCCTGGGCAGAGCGAGGAAGG - Intronic
1186355350 X:8784150-8784172 CTGCCTGAGCAGAGTCCTGCAGG - Intergenic
1186990323 X:15060142-15060164 CAGGCTGAGCAGATAGATGAGGG + Intergenic
1187866581 X:23728311-23728333 CAGCTTGAGCACAATGAAGAGGG + Intronic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189034549 X:37482484-37482506 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1189833887 X:45001514-45001536 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1190076711 X:47322366-47322388 CAGCCTGAGGAGAGTGTGTAGGG - Intergenic
1190270251 X:48857614-48857636 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1190524033 X:51310660-51310682 CTGCGTGAGCAGTGTGCTGAAGG + Intergenic
1190771205 X:53516264-53516286 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191639219 X:63412530-63412552 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191917993 X:66222732-66222754 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1192121923 X:68464554-68464576 CAGCCAGATCAGAGTGAGGAGGG + Intergenic
1193717315 X:84948273-84948295 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195013121 X:100752612-100752634 GAACCTGAGCAGGGTGAGGAAGG + Intergenic
1195271261 X:103233374-103233396 TTGCCTGAGCAGGGTGAGGAAGG + Intergenic
1195846865 X:109238228-109238250 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196423019 X:115541848-115541870 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196460054 X:115920360-115920382 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196553156 X:117054655-117054677 GAGCATGAGCAAAGTTATGAAGG - Intergenic
1196651547 X:118173228-118173250 CAGCCTGAGCACATTGAAGATGG - Intergenic
1196869391 X:120098587-120098609 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1197785298 X:130191989-130192011 CTGCCTGACCAGAGTGTTGGGGG - Intergenic
1198186594 X:134259420-134259442 CAGCCTGTGCTGAGTGAAGTTGG - Intergenic
1198742457 X:139855778-139855800 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1199638339 X:149835062-149835084 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1200094395 X:153650399-153650421 CGGCCTGAGCAGGGTGCTGGGGG + Exonic
1200835450 Y:7727347-7727369 CAGCCTGAGCAGAGAGATAAAGG + Intergenic
1201260088 Y:12150256-12150278 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1201308891 Y:12576729-12576751 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic