ID: 936540692

View in Genome Browser
Species Human (GRCh38)
Location 2:113348428-113348450
Sequence ATGTACATGAATCAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936540692_936540694 2 Left 936540692 2:113348428-113348450 CCATCATCCTGATTCATGTACAT No data
Right 936540694 2:113348453-113348475 TATACCTTGTACCCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936540692 Original CRISPR ATGTACATGAATCAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr