ID: 936540705

View in Genome Browser
Species Human (GRCh38)
Location 2:113348539-113348561
Sequence ATTAAATTCAGTGGGATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936540700_936540705 22 Left 936540700 2:113348494-113348516 CCTGCTCTGAGTCACCTACTGTT No data
Right 936540705 2:113348539-113348561 ATTAAATTCAGTGGGATTAATGG No data
936540699_936540705 28 Left 936540699 2:113348488-113348510 CCTGCTCCTGCTCTGAGTCACCT No data
Right 936540705 2:113348539-113348561 ATTAAATTCAGTGGGATTAATGG No data
936540701_936540705 8 Left 936540701 2:113348508-113348530 CCTACTGTTTCTCTGATACACTG No data
Right 936540705 2:113348539-113348561 ATTAAATTCAGTGGGATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936540705 Original CRISPR ATTAAATTCAGTGGGATTAA TGG Intergenic
No off target data available for this crispr