ID: 936541598

View in Genome Browser
Species Human (GRCh38)
Location 2:113356119-113356141
Sequence GTTTAAACACAGATGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936541598_936541602 18 Left 936541598 2:113356119-113356141 CCTTGGGCCATCTGTGTTTAAAC No data
Right 936541602 2:113356160-113356182 CTTATGGTCAGTATCTGTTGTGG No data
936541598_936541601 2 Left 936541598 2:113356119-113356141 CCTTGGGCCATCTGTGTTTAAAC No data
Right 936541601 2:113356144-113356166 TGTCTGAGATTAGACTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936541598 Original CRISPR GTTTAAACACAGATGGCCCA AGG (reversed) Intergenic
No off target data available for this crispr