ID: 936541951

View in Genome Browser
Species Human (GRCh38)
Location 2:113359469-113359491
Sequence CAGGTAGGAAATCTTGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936541951_936541957 10 Left 936541951 2:113359469-113359491 CCAATTGCAAGATTTCCTACCTG No data
Right 936541957 2:113359502-113359524 GCAAGAGGTGATCAGGCTGTTGG No data
936541951_936541956 3 Left 936541951 2:113359469-113359491 CCAATTGCAAGATTTCCTACCTG No data
Right 936541956 2:113359495-113359517 GTTGATTGCAAGAGGTGATCAGG No data
936541951_936541954 -5 Left 936541951 2:113359469-113359491 CCAATTGCAAGATTTCCTACCTG No data
Right 936541954 2:113359487-113359509 ACCTGTTGGTTGATTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936541951 Original CRISPR CAGGTAGGAAATCTTGCAAT TGG (reversed) Intergenic
No off target data available for this crispr