ID: 936545321

View in Genome Browser
Species Human (GRCh38)
Location 2:113387303-113387325
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936545321_936545322 -5 Left 936545321 2:113387303-113387325 CCTTTCTCTCTTTGAGTCACCAG No data
Right 936545322 2:113387321-113387343 ACCAGTTTCTTTACTGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936545321 Original CRISPR CTGGTGACTCAAAGAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr