ID: 936548565

View in Genome Browser
Species Human (GRCh38)
Location 2:113414292-113414314
Sequence ATAGGGAAGAAAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936548565_936548568 -10 Left 936548565 2:113414292-113414314 CCTTCCTCATTTTTCTTCCCTAT No data
Right 936548568 2:113414305-113414327 TCTTCCCTATAAGCAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936548565 Original CRISPR ATAGGGAAGAAAAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr