ID: 936560986

View in Genome Browser
Species Human (GRCh38)
Location 2:113539723-113539745
Sequence GCGTGGTGGCATGTACCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936560980_936560986 10 Left 936560980 2:113539690-113539712 CCCATGTCTACAAAAACTACAAA 0: 6
1: 278
2: 8676
3: 119036
4: 271590
Right 936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG No data
936560981_936560986 9 Left 936560981 2:113539691-113539713 CCATGTCTACAAAAACTACAAAA 0: 7
1: 450
2: 14183
3: 231904
4: 143756
Right 936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG No data
936560979_936560986 11 Left 936560979 2:113539689-113539711 CCCCATGTCTACAAAAACTACAA 0: 6
1: 268
2: 7871
3: 107908
4: 196727
Right 936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG No data
936560978_936560986 30 Left 936560978 2:113539670-113539692 CCTAGGCAACATGGTGAAACCCC 0: 363
1: 8816
2: 91778
3: 182747
4: 226663
Right 936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936560986 Original CRISPR GCGTGGTGGCATGTACCTGT AGG Intergenic
No off target data available for this crispr