ID: 936561267

View in Genome Browser
Species Human (GRCh38)
Location 2:113541717-113541739
Sequence CGGTCTGGCAGCGGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936561259_936561267 9 Left 936561259 2:113541685-113541707 CCAACTTGGGGAGAAACTGAGGG No data
Right 936561267 2:113541717-113541739 CGGTCTGGCAGCGGAGAAGGTGG No data
936561252_936561267 23 Left 936561252 2:113541671-113541693 CCCCGAAAGTGAGTCCAACTTGG No data
Right 936561267 2:113541717-113541739 CGGTCTGGCAGCGGAGAAGGTGG No data
936561254_936561267 22 Left 936561254 2:113541672-113541694 CCCGAAAGTGAGTCCAACTTGGG No data
Right 936561267 2:113541717-113541739 CGGTCTGGCAGCGGAGAAGGTGG No data
936561256_936561267 21 Left 936561256 2:113541673-113541695 CCGAAAGTGAGTCCAACTTGGGG No data
Right 936561267 2:113541717-113541739 CGGTCTGGCAGCGGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936561267 Original CRISPR CGGTCTGGCAGCGGAGAAGG TGG Intergenic
No off target data available for this crispr