ID: 936562358

View in Genome Browser
Species Human (GRCh38)
Location 2:113552096-113552118
Sequence GGGTGGGCATGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936562358_936562373 24 Left 936562358 2:113552096-113552118 CCCTCTCCCCTCCATGCCCACCC No data
Right 936562373 2:113552143-113552165 CTTAATCTGCTCATTGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936562358 Original CRISPR GGGTGGGCATGGAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr