ID: 936565143

View in Genome Browser
Species Human (GRCh38)
Location 2:113577175-113577197
Sequence CTGAGGGGGCTCTCAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936565143_936565155 7 Left 936565143 2:113577175-113577197 CCCATCCCTGAGAGCCCCCTCAG No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565143_936565151 -6 Left 936565143 2:113577175-113577197 CCCATCCCTGAGAGCCCCCTCAG No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936565143 Original CRISPR CTGAGGGGGCTCTCAGGGAT GGG (reversed) Intergenic