ID: 936565151

View in Genome Browser
Species Human (GRCh38)
Location 2:113577192-113577214
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936565139_936565151 9 Left 936565139 2:113577160-113577182 CCCCTGAGATTTAGCCCCATCCC No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
936565144_936565151 -7 Left 936565144 2:113577176-113577198 CCATCCCTGAGAGCCCCCTCAGA No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
936565138_936565151 13 Left 936565138 2:113577156-113577178 CCTGCCCCTGAGATTTAGCCCCA No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
936565143_936565151 -6 Left 936565143 2:113577175-113577197 CCCATCCCTGAGAGCCCCCTCAG No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
936565142_936565151 -5 Left 936565142 2:113577174-113577196 CCCCATCCCTGAGAGCCCCCTCA No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
936565137_936565151 19 Left 936565137 2:113577150-113577172 CCTAATCCTGCCCCTGAGATTTA No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
936565141_936565151 7 Left 936565141 2:113577162-113577184 CCTGAGATTTAGCCCCATCCCTG No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
936565140_936565151 8 Left 936565140 2:113577161-113577183 CCCTGAGATTTAGCCCCATCCCT No data
Right 936565151 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type