ID: 936565155

View in Genome Browser
Species Human (GRCh38)
Location 2:113577205-113577227
Sequence CACAGCCAGGACACCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936565150_936565155 -10 Left 936565150 2:113577192-113577214 CCTCAGAGCCACCCACAGCCAGG No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565147_936565155 -7 Left 936565147 2:113577189-113577211 CCCCCTCAGAGCCACCCACAGCC No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565148_936565155 -8 Left 936565148 2:113577190-113577212 CCCCTCAGAGCCACCCACAGCCA No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565149_936565155 -9 Left 936565149 2:113577191-113577213 CCCTCAGAGCCACCCACAGCCAG No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565140_936565155 21 Left 936565140 2:113577161-113577183 CCCTGAGATTTAGCCCCATCCCT No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565146_936565155 1 Left 936565146 2:113577181-113577203 CCTGAGAGCCCCCTCAGAGCCAC No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565141_936565155 20 Left 936565141 2:113577162-113577184 CCTGAGATTTAGCCCCATCCCTG No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565143_936565155 7 Left 936565143 2:113577175-113577197 CCCATCCCTGAGAGCCCCCTCAG No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565138_936565155 26 Left 936565138 2:113577156-113577178 CCTGCCCCTGAGATTTAGCCCCA No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565144_936565155 6 Left 936565144 2:113577176-113577198 CCATCCCTGAGAGCCCCCTCAGA No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565139_936565155 22 Left 936565139 2:113577160-113577182 CCCCTGAGATTTAGCCCCATCCC No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565142_936565155 8 Left 936565142 2:113577174-113577196 CCCCATCCCTGAGAGCCCCCTCA No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data
936565145_936565155 2 Left 936565145 2:113577180-113577202 CCCTGAGAGCCCCCTCAGAGCCA No data
Right 936565155 2:113577205-113577227 CACAGCCAGGACACCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936565155 Original CRISPR CACAGCCAGGACACCTCTGC TGG Intergenic