ID: 936565730

View in Genome Browser
Species Human (GRCh38)
Location 2:113581322-113581344
Sequence AAGGCTGCAGGGTTGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936565730_936565738 6 Left 936565730 2:113581322-113581344 CCTGGGACCAACCCTGCAGCCTT No data
Right 936565738 2:113581351-113581373 CCAGGCCCACTCAGCCCAGCTGG No data
936565730_936565741 16 Left 936565730 2:113581322-113581344 CCTGGGACCAACCCTGCAGCCTT No data
Right 936565741 2:113581361-113581383 TCAGCCCAGCTGGCCAGCAAAGG No data
936565730_936565745 24 Left 936565730 2:113581322-113581344 CCTGGGACCAACCCTGCAGCCTT No data
Right 936565745 2:113581369-113581391 GCTGGCCAGCAAAGGCAGGCAGG No data
936565730_936565746 25 Left 936565730 2:113581322-113581344 CCTGGGACCAACCCTGCAGCCTT No data
Right 936565746 2:113581370-113581392 CTGGCCAGCAAAGGCAGGCAGGG No data
936565730_936565743 20 Left 936565730 2:113581322-113581344 CCTGGGACCAACCCTGCAGCCTT No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936565730 Original CRISPR AAGGCTGCAGGGTTGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr