ID: 936565743

View in Genome Browser
Species Human (GRCh38)
Location 2:113581365-113581387
Sequence CCCAGCTGGCCAGCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936565736_936565743 -8 Left 936565736 2:113581350-113581372 CCCAGGCCCACTCAGCCCAGCTG No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data
936565732_936565743 9 Left 936565732 2:113581333-113581355 CCCTGCAGCCTTAATTTCCCAGG No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data
936565734_936565743 8 Left 936565734 2:113581334-113581356 CCTGCAGCCTTAATTTCCCAGGC No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data
936565735_936565743 1 Left 936565735 2:113581341-113581363 CCTTAATTTCCCAGGCCCACTCA No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data
936565731_936565743 13 Left 936565731 2:113581329-113581351 CCAACCCTGCAGCCTTAATTTCC No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data
936565730_936565743 20 Left 936565730 2:113581322-113581344 CCTGGGACCAACCCTGCAGCCTT No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data
936565737_936565743 -9 Left 936565737 2:113581351-113581373 CCAGGCCCACTCAGCCCAGCTGG No data
Right 936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936565743 Original CRISPR CCCAGCTGGCCAGCAAAGGC AGG Intergenic
No off target data available for this crispr