ID: 936565785

View in Genome Browser
Species Human (GRCh38)
Location 2:113581625-113581647
Sequence ACCACATCATATACCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936565785_936565787 4 Left 936565785 2:113581625-113581647 CCAGGCTTGGTATATGATGTGGT No data
Right 936565787 2:113581652-113581674 GTGTATATTCACAGGCATCGTGG No data
936565785_936565786 -4 Left 936565785 2:113581625-113581647 CCAGGCTTGGTATATGATGTGGT No data
Right 936565786 2:113581644-113581666 TGGTGTGTGTGTATATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936565785 Original CRISPR ACCACATCATATACCAAGCC TGG (reversed) Intergenic
No off target data available for this crispr