ID: 936565787

View in Genome Browser
Species Human (GRCh38)
Location 2:113581652-113581674
Sequence GTGTATATTCACAGGCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936565785_936565787 4 Left 936565785 2:113581625-113581647 CCAGGCTTGGTATATGATGTGGT No data
Right 936565787 2:113581652-113581674 GTGTATATTCACAGGCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936565787 Original CRISPR GTGTATATTCACAGGCATCG TGG Intergenic
No off target data available for this crispr