ID: 936567387

View in Genome Browser
Species Human (GRCh38)
Location 2:113591814-113591836
Sequence TTGTGTCCCCACGGTGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936567377_936567387 22 Left 936567377 2:113591769-113591791 CCAGGCCTCTTTGAATGGGGCTG No data
Right 936567387 2:113591814-113591836 TTGTGTCCCCACGGTGCCACGGG No data
936567373_936567387 30 Left 936567373 2:113591761-113591783 CCTGTGGGCCAGGCCTCTTTGAA No data
Right 936567387 2:113591814-113591836 TTGTGTCCCCACGGTGCCACGGG No data
936567380_936567387 17 Left 936567380 2:113591774-113591796 CCTCTTTGAATGGGGCTGAGGGA No data
Right 936567387 2:113591814-113591836 TTGTGTCCCCACGGTGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936567387 Original CRISPR TTGTGTCCCCACGGTGCCAC GGG Intergenic
No off target data available for this crispr