ID: 936569280

View in Genome Browser
Species Human (GRCh38)
Location 2:113601330-113601352
Sequence AGCCATGCCTAGAGTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936569280_936569289 23 Left 936569280 2:113601330-113601352 CCCATCCCACTCTAGGCATGGCT No data
Right 936569289 2:113601376-113601398 CCAGTGCTCAGCTTGCACCCTGG No data
936569280_936569290 29 Left 936569280 2:113601330-113601352 CCCATCCCACTCTAGGCATGGCT No data
Right 936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936569280 Original CRISPR AGCCATGCCTAGAGTGGGAT GGG (reversed) Intergenic
No off target data available for this crispr