ID: 936569289

View in Genome Browser
Species Human (GRCh38)
Location 2:113601376-113601398
Sequence CCAGTGCTCAGCTTGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936569281_936569289 22 Left 936569281 2:113601331-113601353 CCATCCCACTCTAGGCATGGCTC No data
Right 936569289 2:113601376-113601398 CCAGTGCTCAGCTTGCACCCTGG No data
936569285_936569289 0 Left 936569285 2:113601353-113601375 CCTCTCCACAGGAAAACTCCACT No data
Right 936569289 2:113601376-113601398 CCAGTGCTCAGCTTGCACCCTGG No data
936569282_936569289 18 Left 936569282 2:113601335-113601357 CCCACTCTAGGCATGGCTCCTCT No data
Right 936569289 2:113601376-113601398 CCAGTGCTCAGCTTGCACCCTGG No data
936569283_936569289 17 Left 936569283 2:113601336-113601358 CCACTCTAGGCATGGCTCCTCTC No data
Right 936569289 2:113601376-113601398 CCAGTGCTCAGCTTGCACCCTGG No data
936569286_936569289 -5 Left 936569286 2:113601358-113601380 CCACAGGAAAACTCCACTCCAGT No data
Right 936569289 2:113601376-113601398 CCAGTGCTCAGCTTGCACCCTGG No data
936569280_936569289 23 Left 936569280 2:113601330-113601352 CCCATCCCACTCTAGGCATGGCT No data
Right 936569289 2:113601376-113601398 CCAGTGCTCAGCTTGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936569289 Original CRISPR CCAGTGCTCAGCTTGCACCC TGG Intergenic
No off target data available for this crispr