ID: 936569290

View in Genome Browser
Species Human (GRCh38)
Location 2:113601382-113601404
Sequence CTCAGCTTGCACCCTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936569286_936569290 1 Left 936569286 2:113601358-113601380 CCACAGGAAAACTCCACTCCAGT No data
Right 936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG No data
936569282_936569290 24 Left 936569282 2:113601335-113601357 CCCACTCTAGGCATGGCTCCTCT No data
Right 936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG No data
936569281_936569290 28 Left 936569281 2:113601331-113601353 CCATCCCACTCTAGGCATGGCTC No data
Right 936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG No data
936569285_936569290 6 Left 936569285 2:113601353-113601375 CCTCTCCACAGGAAAACTCCACT No data
Right 936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG No data
936569280_936569290 29 Left 936569280 2:113601330-113601352 CCCATCCCACTCTAGGCATGGCT No data
Right 936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG No data
936569283_936569290 23 Left 936569283 2:113601336-113601358 CCACTCTAGGCATGGCTCCTCTC No data
Right 936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936569290 Original CRISPR CTCAGCTTGCACCCTGGCAC AGG Intergenic
No off target data available for this crispr