ID: 936569833

View in Genome Browser
Species Human (GRCh38)
Location 2:113603713-113603735
Sequence CAAAGGCGGCGCGCCGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936569824_936569833 28 Left 936569824 2:113603662-113603684 CCTCGCGATGCTCTCCGGCTGTG No data
Right 936569833 2:113603713-113603735 CAAAGGCGGCGCGCCGGCGGAGG No data
936569823_936569833 29 Left 936569823 2:113603661-113603683 CCCTCGCGATGCTCTCCGGCTGT No data
Right 936569833 2:113603713-113603735 CAAAGGCGGCGCGCCGGCGGAGG No data
936569825_936569833 14 Left 936569825 2:113603676-113603698 CCGGCTGTGTGCTAAAGAGAACG No data
Right 936569833 2:113603713-113603735 CAAAGGCGGCGCGCCGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936569833 Original CRISPR CAAAGGCGGCGCGCCGGCGG AGG Intergenic