ID: 936572279

View in Genome Browser
Species Human (GRCh38)
Location 2:113627077-113627099
Sequence TCAGTACCACACCCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 2, 2: 0, 3: 29, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936572270_936572279 17 Left 936572270 2:113627037-113627059 CCGCTCCACTCCCTCTAGGCGGG 0: 2
1: 0
2: 3
3: 14
4: 223
Right 936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG 0: 1
1: 2
2: 0
3: 29
4: 197
936572267_936572279 30 Left 936572267 2:113627024-113627046 CCTGACGTGCTCACCGCTCCACT 0: 2
1: 0
2: 0
3: 3
4: 72
Right 936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG 0: 1
1: 2
2: 0
3: 29
4: 197
936572273_936572279 12 Left 936572273 2:113627042-113627064 CCACTCCCTCTAGGCGGGCGGCA 0: 2
1: 0
2: 0
3: 4
4: 94
Right 936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG 0: 1
1: 2
2: 0
3: 29
4: 197
936572275_936572279 6 Left 936572275 2:113627048-113627070 CCTCTAGGCGGGCGGCACCCGCT 0: 2
1: 0
2: 0
3: 1
4: 39
Right 936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG 0: 1
1: 2
2: 0
3: 29
4: 197
936572274_936572279 7 Left 936572274 2:113627047-113627069 CCCTCTAGGCGGGCGGCACCCGC 0: 2
1: 0
2: 0
3: 4
4: 51
Right 936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG 0: 1
1: 2
2: 0
3: 29
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936572279 Original CRISPR TCAGTACCACACCCACAGCC AGG Intergenic
900469958 1:2848894-2848916 TCAGTTCCACACTCCCACCCAGG - Intergenic
902761523 1:18583858-18583880 CCAGAACCACACCCACACCCTGG - Intergenic
903025539 1:20427565-20427587 TCACTGCCACACCCCCAACCTGG + Intergenic
903674750 1:25056602-25056624 TCAGTCTCACACCCGCTGCCTGG - Intergenic
905370481 1:37480170-37480192 TCACTACCACCACCAAAGCCAGG + Intronic
905462149 1:38128999-38129021 TCAGGTCCAAGCCCACAGCCAGG - Intergenic
905788786 1:40779072-40779094 TCAGTGCCACACCCAGATCTGGG + Intergenic
906812930 1:48847813-48847835 TCAGTACCAAACACAGAACCTGG + Intronic
907936514 1:59046829-59046851 TCACTACCACACCCACAGGAGGG - Intergenic
908085322 1:60625815-60625837 TCAGTGCCACAGCCTCAGCCAGG - Intergenic
910652372 1:89583263-89583285 TCATTGCCCTACCCACAGCCAGG + Exonic
910785344 1:90991726-90991748 TCACTACCACAACAACAGCAAGG + Intronic
912580874 1:110719822-110719844 TCAGTTCCTCACCAACACCCAGG - Intergenic
913452610 1:119002172-119002194 TCTGGTCCACACCCACATCCGGG - Intergenic
918189426 1:182158413-182158435 TCAGTGCCAAACCCAAAGTCAGG + Intergenic
919482735 1:198109380-198109402 TTAGAACCACACCAACAGCAAGG - Intergenic
920380968 1:205534359-205534381 TGAGTTCCACACCCCCAGGCTGG - Intergenic
922681100 1:227596521-227596543 TAACTACCACACCCAGAGCCTGG + Intronic
922856075 1:228775655-228775677 TCAGTGCCACAGCCACAATCAGG - Intergenic
924858280 1:247896189-247896211 ACAGCACAACACCCACCGCCAGG - Exonic
1062939376 10:1410084-1410106 TCAGCACCATGACCACAGCCAGG - Intronic
1067278329 10:44853437-44853459 TCAGCACCTCACCCAGAGCCAGG + Intergenic
1069848502 10:71390063-71390085 TCAATACCATAACCACAGGCTGG - Intergenic
1074780560 10:116799061-116799083 TGACTACCACTCCCACAGCCTGG + Intergenic
1074914999 10:117947127-117947149 TCATGGCCACACCCAAAGCCAGG + Intergenic
1076988663 11:257619-257641 TGAGTCCCCCACCCACAGCAAGG + Intergenic
1078070544 11:8106441-8106463 TCAGAACCACACCCAGAGGCTGG + Intronic
1078408897 11:11095326-11095348 CCAGCACCAGACTCACAGCCAGG - Intergenic
1078907404 11:15700388-15700410 TAAGTACCAAGCCCAGAGCCTGG + Intergenic
1084548910 11:69829061-69829083 TCAGTCCCACACTCACAGTAGGG - Intergenic
1084941451 11:72615443-72615465 TCAGTCCCTCACCCAGAGTCTGG + Intronic
1087016796 11:93561825-93561847 TCAGAACTGGACCCACAGCCAGG + Intergenic
1089479433 11:118792254-118792276 TCAGTCGCACTCTCACAGCCCGG - Intergenic
1091754056 12:3040445-3040467 TCAGCACCACATCTACAGGCTGG + Exonic
1093296802 12:17401040-17401062 GCAGTGCCCCACCCCCAGCCTGG - Intergenic
1094355474 12:29573430-29573452 TCAGTACCACACACTGTGCCAGG + Intronic
1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG + Intronic
1095374056 12:41505235-41505257 TCAGTGCCTCACCAACAGGCGGG + Intronic
1096321883 12:50621544-50621566 ACTGTAGCCCACCCACAGCCTGG - Intronic
1096475507 12:51906978-51907000 TCCTTACCCCACCCTCAGCCCGG - Intronic
1096799345 12:54099346-54099368 TCACCACCACTCCCTCAGCCAGG + Intergenic
1097249448 12:57624553-57624575 AGAAGACCACACCCACAGCCAGG - Intronic
1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG + Intronic
1101367812 12:104091746-104091768 TAAGTAATACACCTACAGCCAGG - Intronic
1104108698 12:125686762-125686784 TCAGTACCTCACCCACATCAAGG - Intergenic
1104346805 12:128007435-128007457 TGACTCCCACAGCCACAGCCTGG - Intergenic
1104877838 12:132048843-132048865 TCAGAACATCACCCACAGCCAGG - Intronic
1105639539 13:22248055-22248077 TCACTACCAAAACGACAGCCTGG - Intergenic
1108131508 13:47306481-47306503 GCTTTACCACACACACAGCCAGG - Intergenic
1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG + Intergenic
1110345289 13:74439926-74439948 TCACCACCACCCCCACACCCTGG - Intergenic
1110385883 13:74910321-74910343 TCAGTACCATATCCATATCCTGG + Intergenic
1118768661 14:68927336-68927358 TCAGCTCCACACCCCCAGCCTGG + Intronic
1120025050 14:79573821-79573843 TCTGTACCATACCCTCAGCCTGG - Intronic
1121426724 14:93857541-93857563 TCACTACCACAGCTACAGCTTGG - Intergenic
1123885840 15:24727600-24727622 TCCTTGCCACACCCACAGCCTGG + Intergenic
1127517571 15:59710897-59710919 TCCTTATCACACCCCCAGCCCGG - Intergenic
1127604240 15:60570146-60570168 TCAGTAACACAAACACAGCCCGG + Intronic
1127687011 15:61356057-61356079 TCATTCCCAAACTCACAGCCAGG - Intergenic
1130606095 15:85318401-85318423 TCAATGCCACACCCACATTCTGG + Intergenic
1132500434 16:282499-282521 TCTGCACCACACCTACCGCCGGG + Exonic
1133783896 16:8960671-8960693 CCAGGACCCCACTCACAGCCTGG + Intronic
1134674948 16:16083703-16083725 CCTGAGCCACACCCACAGCCTGG - Intronic
1136607827 16:31348439-31348461 TCCGTCCTACACCCACAGACAGG - Intergenic
1136872361 16:33819287-33819309 TCATTATCACACGAACAGCCTGG + Intergenic
1137908379 16:52349901-52349923 TCATAACCACTCCCACAGCCAGG - Intergenic
1138190385 16:55009441-55009463 TGACTGCCACACCCCCAGCCCGG - Intergenic
1138456212 16:57122212-57122234 TCTGGCCCCCACCCACAGCCTGG - Intronic
1139953571 16:70683148-70683170 TCTGAACCACAGCCACTGCCGGG - Intronic
1140208212 16:72950528-72950550 TGACTACTACACCAACAGCCTGG - Exonic
1141007242 16:80363738-80363760 GGAGTAACACAGCCACAGCCAGG - Intergenic
1141804364 16:86332981-86333003 TCAGCACTTCACCCAGAGCCTGG - Intergenic
1142194992 16:88735285-88735307 CCAGCACCCCTCCCACAGCCGGG + Intronic
1142383648 16:89748483-89748505 GGAGGACCCCACCCACAGCCAGG - Intronic
1203099811 16_KI270728v1_random:1296781-1296803 TCATTATCACACGAACAGCCTGG - Intergenic
1142666076 17:1464573-1464595 TCACTGCCACTCCCAGAGCCAGG - Exonic
1144208496 17:12995722-12995744 GCAGTACCACAACCAGTGCCAGG - Exonic
1146065196 17:29629323-29629345 CCAGTATCTCAACCACAGCCAGG - Exonic
1147170759 17:38617433-38617455 TCAGTGCCCCACCCACAGGCTGG - Intergenic
1148450700 17:47776033-47776055 ACAGTAACACAGTCACAGCCAGG - Intergenic
1150235952 17:63592839-63592861 TCTGTAACAAACCCACAACCAGG - Exonic
1152286239 17:79414866-79414888 TCTGTCCCAGACCCACTGCCAGG - Intronic
1152810591 17:82380127-82380149 TCACACCCACACCCACAGCTGGG + Intergenic
1154172979 18:12063983-12064005 TGAGTGACACACACACAGCCAGG - Intergenic
1155365667 18:25047116-25047138 TCAGTACCATCCCCAGAGGCAGG + Intergenic
1156520916 18:37721718-37721740 TCACTACCACATTCACAGCCAGG - Intergenic
1157433620 18:47651072-47651094 TGAGTCCTACACCCACAGGCAGG + Intergenic
1158574921 18:58628822-58628844 TCAATGCCTCACACACAGCCTGG - Exonic
1160417357 18:78720691-78720713 ACAGTACAAAACCCGCAGCCTGG - Intergenic
1161484712 19:4529127-4529149 CCAGTACAACATCCACAGCATGG + Exonic
1161697662 19:5778594-5778616 TCAGGGCCTCAGCCACAGCCAGG + Exonic
1161810081 19:6466522-6466544 ACAGTGCCAGCCCCACAGCCAGG - Exonic
1162967209 19:14161583-14161605 TCAGCACGACCACCACAGCCAGG - Exonic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1163709771 19:18839744-18839766 TCAGTCCCACAAGCACAGCAAGG - Intronic
1163991434 19:21002487-21002509 CCAGTGCCACACCCTGAGCCTGG + Intergenic
1167747045 19:51358013-51358035 TCAGTACATCAGCCAGAGCCGGG + Intronic
1167756829 19:51417889-51417911 CCACTACCCCACCCCCAGCCAGG - Intergenic
1168093554 19:54101514-54101536 ACAGTATCACACCAAGAGCCTGG - Intronic
1168714383 19:58518501-58518523 TCTGTGCCACACCCACACCCTGG - Intronic
925280823 2:2683265-2683287 TCACCACCACACACACACCCAGG - Intergenic
926314296 2:11697929-11697951 TCAGGAAGCCACCCACAGCCGGG - Intronic
927458296 2:23276239-23276261 TCAGAGCCACACCCTCACCCAGG + Intergenic
927888168 2:26731064-26731086 TCACGACCACACCCCCACCCCGG + Exonic
928574426 2:32640467-32640489 TCAGCAACACATCTACAGCCTGG - Intronic
929251305 2:39758475-39758497 TCACTACCCAACCCACAGCAGGG - Intronic
929627495 2:43424532-43424554 TCAGAACCACAAGCACTGCCTGG + Intronic
932074862 2:68653382-68653404 TCTGTCCCTCCCCCACAGCCTGG - Intronic
935735828 2:106105985-106106007 TCAGCACCAGACACTCAGCCTGG + Intronic
936392873 2:112091399-112091421 TCCATACCAAACCGACAGCCAGG - Intronic
936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG + Intergenic
937276185 2:120685600-120685622 TCAGTCCCACACCCAGAGTAGGG + Intergenic
937298719 2:120825494-120825516 TCAGGTGCACACCCACAGCCAGG - Intronic
937298724 2:120825551-120825573 CCAGGAGCACACTCACAGCCAGG - Intronic
937298728 2:120825569-120825591 CCAGGTGCACACCCACAGCCAGG - Intronic
942441652 2:176043081-176043103 TCACTACCACAAGAACAGCCTGG - Intergenic
943179540 2:184525078-184525100 CCAGGACCACAGCCACAGCTGGG + Intergenic
944580370 2:201126987-201127009 TCTTTTCCACACCCACACCCTGG - Intronic
945305431 2:208254992-208255014 TCAGACTCACAACCACAGCCTGG + Intronic
945724081 2:213453697-213453719 TCAGTGCCACACTCACTGCCTGG - Intronic
946409120 2:219507686-219507708 ACAGCTCCACACCCACAGCTGGG - Intergenic
947722527 2:232378586-232378608 TCAGGACCCCAGCCCCAGCCCGG + Exonic
948276187 2:236710838-236710860 TCAGTACAACATCCACCTCCCGG + Intergenic
1169182776 20:3584694-3584716 TCAGTACACCAGCCACAGCCTGG - Exonic
1173703764 20:45095283-45095305 ACACTGACACACCCACAGCCAGG + Exonic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1174238142 20:49111103-49111125 TCTGTAGTACACCCTCAGCCTGG - Intergenic
1174252310 20:49228878-49228900 CCAGAAACTCACCCACAGCCAGG - Exonic
1174506467 20:51020876-51020898 TCTGCACCAGACCCACAGCTGGG - Intronic
1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG + Intergenic
1177519332 21:22197629-22197651 TCAGTGCCACACCCTGGGCCTGG + Intergenic
1177790251 21:25715159-25715181 TCACTAACACACCCACAGAAAGG + Intronic
1178140241 21:29674582-29674604 TCACTACCACAAGAACAGCCTGG - Intronic
1179261985 21:39765531-39765553 TCATTACCAGACCCAGAACCTGG - Exonic
1181675324 22:24447559-24447581 CCAGTTCCACACCCACCTCCCGG - Intergenic
1182072516 22:27473836-27473858 TCCATCCCCCACCCACAGCCGGG + Intergenic
1182517644 22:30868124-30868146 GCAGCGCCTCACCCACAGCCTGG + Intronic
1183047280 22:35230077-35230099 TGAGTACCAGACACACAGCGAGG + Intergenic
1183102372 22:35591874-35591896 TCCCTACCACACACACAGGCAGG - Intergenic
1183413401 22:37668642-37668664 CCAGGACCACACCCAAAGCCAGG - Intergenic
1184835845 22:47020517-47020539 ACAGTGCCACACCAACAGGCAGG - Intronic
1185001621 22:48249975-48249997 TCCTTAGCTCACCCACAGCCTGG + Intergenic
1185097683 22:48820692-48820714 TCGGCACCACACCTGCAGCCTGG + Intronic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
1185427909 22:50783803-50783825 TCGGTACCACACCCACAGCCAGG - Intergenic
950089669 3:10286749-10286771 TCAGTACCAGCAGCACAGCCAGG - Exonic
953188373 3:40660014-40660036 TCAGAACCATAACTACAGCCAGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954692570 3:52403434-52403456 TCAGCACCCCATCCTCAGCCAGG + Exonic
955776930 3:62443578-62443600 TCAGTATCACAAGAACAGCCTGG - Intronic
959532255 3:107447119-107447141 TCAGTCCTTCACCCAAAGCCTGG + Intergenic
960019459 3:112932716-112932738 TCAGTTCCATACCCACAACTGGG + Intronic
960542564 3:118877977-118877999 TCAACACCACACACTCAGCCTGG + Intergenic
962105375 3:132383538-132383560 TCAGTTCCACAGCCACAGCTTGG + Intergenic
964824665 3:160811947-160811969 TCAGTGCCACACCAAGTGCCTGG - Intronic
968066816 3:195763444-195763466 TCAGTACCGCTCCAGCAGCCTGG - Exonic
968634546 4:1671229-1671251 TCACAGCCACAGCCACAGCCCGG + Intronic
968634590 4:1671441-1671463 TCACAGCCACAGCCACAGCCGGG + Intronic
968634613 4:1671553-1671575 TCACAGCCACAGCCACAGCCGGG + Intronic
968901117 4:3432447-3432469 GCAGTCCCGCACCCACACCCCGG + Intronic
971264181 4:25083630-25083652 CCAGTACCACACCCTGGGCCTGG - Intergenic
971648407 4:29238264-29238286 ACAGTCCCACTCCCACACCCAGG - Intergenic
972594135 4:40515480-40515502 GCAGAATCACACCCACAGGCAGG + Intronic
973807180 4:54537857-54537879 TCACTGTCACACCCACACCCTGG - Intergenic
974153310 4:58038452-58038474 TGAGTACCACACTCACCACCAGG - Intergenic
974990286 4:69078821-69078843 CCAGTAACACACCAACAGCATGG - Intronic
977046361 4:92072780-92072802 ACCATACCACACCCACAGACCGG + Intergenic
980897044 4:138869767-138869789 TCTGTGCCAGGCCCACAGCCAGG + Intergenic
987348170 5:16997247-16997269 GCAGTTCCACACCCAGAGGCAGG - Intergenic
988276894 5:29092138-29092160 CCAGCACCACACCCAGGGCCTGG + Intergenic
988480653 5:31627703-31627725 TCAGTACCTGACACACAGCCTGG - Intergenic
989092724 5:37750641-37750663 TCAGTATCACAACAACAGCATGG - Intronic
991666591 5:69005784-69005806 TAAGAACCAGACCCTCAGCCAGG + Intergenic
994695937 5:103073634-103073656 TCAGTACCACAAGAACAGCATGG - Intergenic
995603534 5:113825509-113825531 TCAGAACCACACCTAGTGCCTGG - Intergenic
998410015 5:141902784-141902806 TCAATACCACACCAGCAGCTGGG - Intergenic
998426748 5:142035290-142035312 TTAATCCCCCACCCACAGCCAGG - Intergenic
1000230039 5:159307254-159307276 TCTGCACCACACCCACACCTGGG - Intergenic
1001979963 5:176031257-176031279 TCCGTCCCAAACCCACAGCCAGG - Intronic
1002074890 5:176702529-176702551 TCAAAACCACACACACAGGCCGG - Intergenic
1002237419 5:177812406-177812428 TCCGTCCCAAACCCACAGCCAGG + Intergenic
1002276010 5:178104798-178104820 TCTGTCCCAAACCCGCAGCCAGG - Intergenic
1002724615 5:181286374-181286396 TCTGTCTCAAACCCACAGCCAGG + Intergenic
1002809000 6:607222-607244 TCAAAACCACACACACAGCACGG + Intronic
1005015417 6:21370799-21370821 TCTGTTTCACACCCACAGCTGGG + Intergenic
1006410590 6:33871143-33871165 TCAATGCCACCCCCACAGCTGGG + Intergenic
1006487547 6:34356082-34356104 CCAGTATCACAGACACAGCCAGG - Intronic
1007654804 6:43445615-43445637 TCAATGCCACACCCACGGGCCGG + Exonic
1007765893 6:44159486-44159508 CCTGTACCTCACCCTCAGCCTGG + Intronic
1010042498 6:71402280-71402302 TCAGTTCCAGACCCAGGGCCTGG + Intergenic
1011204249 6:84874462-84874484 TGTGTGCCATACCCACAGCCAGG - Intergenic
1012051982 6:94358412-94358434 ACAGTAAGACACTCACAGCCTGG + Intergenic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1013694148 6:112681546-112681568 CCTGTACCCAACCCACAGCCTGG + Intergenic
1017815359 6:158012261-158012283 TAAGTGCCACATTCACAGCCTGG - Intronic
1018390744 6:163339274-163339296 CCAGTTACACAGCCACAGCCTGG - Intergenic
1019922819 7:4173775-4173797 ACAGTACGGCAGCCACAGCCTGG + Intronic
1021168172 7:17366101-17366123 TCAGTAACACGCCCACCTCCAGG + Intergenic
1024171952 7:46798015-46798037 TCACTATCACAACAACAGCCAGG + Intergenic
1026598313 7:71752647-71752669 TCCTTTCCACACCAACAGCCTGG - Intergenic
1027400113 7:77798438-77798460 TCAGTGCCGCGCCCACATCCGGG + Exonic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1029478202 7:100797625-100797647 TGAGAACCAACCCCACAGCCCGG + Intronic
1029868630 7:103663653-103663675 TCAGTACCAAAGCCTAAGCCTGG - Intronic
1031614344 7:123863782-123863804 TGAGTACTACACTCACAGCTAGG - Intronic
1032152242 7:129439086-129439108 TCAGCACCACCCCCACATCCAGG - Intronic
1033261654 7:139849302-139849324 TCACTACAACATCCACATCCTGG - Intronic
1037135225 8:15452042-15452064 TCAGCACCATCCCCACTGCCTGG + Intronic
1037754526 8:21702496-21702518 TCACTGCCCCACACACAGCCAGG + Intronic
1040551642 8:48442348-48442370 TCAGAGCCACATCCACAGCATGG - Intergenic
1043394193 8:79820957-79820979 TCAGTACCAAGCCCAGTGCCTGG - Intergenic
1044791563 8:95852697-95852719 ACAGTAAATCACCCACAGCCTGG + Intergenic
1049185653 8:141251293-141251315 TCAGTTCCACGAACACAGCCAGG + Intronic
1049264067 8:141657462-141657484 TCAGGGCCACACATACAGCCTGG + Intergenic
1049716979 8:144097662-144097684 TCTGTCCCACACCCACTGTCTGG - Intergenic
1056717375 9:89043224-89043246 TCATTCTCACACCTACAGCCTGG - Intronic
1056824063 9:89864603-89864625 TCAGGACCACACACACAGAGGGG + Intergenic
1057899897 9:98940466-98940488 TCCCTCCCACACCCACAGCTGGG + Intergenic
1060104823 9:120866993-120867015 CCAGGACCACACCCCCAGTCAGG + Intronic
1060409433 9:123390330-123390352 TTTGTACCACAGCCACAGTCTGG - Intronic
1061101366 9:128494961-128494983 TCAGCTCCACACCCACAGCTGGG + Intronic
1061516461 9:131093105-131093127 TCATATGCACACCCACAGCCAGG - Intronic
1062645888 9:137547905-137547927 TCACTAACACACCCACATGCTGG + Intronic
1186557681 X:10577110-10577132 TCAGCTCAACACCCACTGCCTGG + Intronic
1189349019 X:40263312-40263334 TCAGGACCACAGCCAAAGTCAGG + Intergenic
1189744617 X:44157311-44157333 TCAGAACAAGCCCCACAGCCAGG - Intronic
1192207030 X:69103113-69103135 TCAGAAGCACCCCCACAGACTGG - Intergenic
1195788267 X:108552096-108552118 TCAGTACGACACTCACTACCTGG + Intronic
1197819580 X:130530543-130530565 GCAGCACCACCCCCACAGCCTGG + Intergenic