ID: 936576866

View in Genome Browser
Species Human (GRCh38)
Location 2:113664456-113664478
Sequence CCCTTAGATGTCTAGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936576861_936576866 2 Left 936576861 2:113664431-113664453 CCCTCGGATGTCTAGGTGGGCAC No data
Right 936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG No data
936576860_936576866 3 Left 936576860 2:113664430-113664452 CCCCTCGGATGTCTAGGTGGGCA No data
Right 936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG No data
936576855_936576866 27 Left 936576855 2:113664406-113664428 CCGTCGGATGTCTAGGTGGGCAC No data
Right 936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG No data
936576862_936576866 1 Left 936576862 2:113664432-113664454 CCTCGGATGTCTAGGTGGGCACA No data
Right 936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG No data
936576854_936576866 28 Left 936576854 2:113664405-113664427 CCCGTCGGATGTCTAGGTGGGCA No data
Right 936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936576866 Original CRISPR CCCTTAGATGTCTAGGTCCC TGG Intergenic
No off target data available for this crispr