ID: 936588532

View in Genome Browser
Species Human (GRCh38)
Location 2:113780599-113780621
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936588529_936588532 16 Left 936588529 2:113780560-113780582 CCTGAGACTGGAAAATTGATAAA No data
Right 936588532 2:113780599-113780621 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
936588528_936588532 17 Left 936588528 2:113780559-113780581 CCCTGAGACTGGAAAATTGATAA No data
Right 936588532 2:113780599-113780621 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936588532 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr