ID: 936589081

View in Genome Browser
Species Human (GRCh38)
Location 2:113785724-113785746
Sequence CAGAAGAAGGAAAAGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936589081_936589092 18 Left 936589081 2:113785724-113785746 CCTCACTCCTTTTCCTTCTTCTG No data
Right 936589092 2:113785765-113785787 ATTCTTCAGGGTTTGGATCAAGG No data
936589081_936589088 6 Left 936589081 2:113785724-113785746 CCTCACTCCTTTTCCTTCTTCTG No data
Right 936589088 2:113785753-113785775 GAAATGACACCCATTCTTCAGGG No data
936589081_936589087 5 Left 936589081 2:113785724-113785746 CCTCACTCCTTTTCCTTCTTCTG No data
Right 936589087 2:113785752-113785774 GGAAATGACACCCATTCTTCAGG No data
936589081_936589089 11 Left 936589081 2:113785724-113785746 CCTCACTCCTTTTCCTTCTTCTG No data
Right 936589089 2:113785758-113785780 GACACCCATTCTTCAGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936589081 Original CRISPR CAGAAGAAGGAAAAGGAGTG AGG (reversed) Intergenic
No off target data available for this crispr