ID: 936603573

View in Genome Browser
Species Human (GRCh38)
Location 2:113924756-113924778
Sequence CAGGGGAATGAGAGGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936603573_936603581 18 Left 936603573 2:113924756-113924778 CCTCCATACCTCTCATTCCCCTG 0: 1
1: 0
2: 0
3: 27
4: 388
Right 936603581 2:113924797-113924819 AGCAGAACTGAGTTAAGACCCGG 0: 1
1: 0
2: 1
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936603573 Original CRISPR CAGGGGAATGAGAGGTATGG AGG (reversed) Intronic
900473473 1:2865608-2865630 CAGGGGCCTGAGAGGTGAGGTGG + Intergenic
901837800 1:11935345-11935367 CATGGGAATGAGGGGTCTTGAGG + Intronic
902686526 1:18080997-18081019 CAGTGCACAGAGAGGTATGGTGG - Intergenic
902892129 1:19452142-19452164 CATGGGATGGAGAGGGATGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903339294 1:22643944-22643966 CTGGGGAATGAGAGGGTTGGGGG + Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904748271 1:32724790-32724812 CTGGGGAATGAGGGGTGTGGGGG + Intergenic
904939791 1:34157616-34157638 CAGGGGATTGACTGGGATGGGGG - Intronic
905330484 1:37192050-37192072 CTGGGGAATGGGTGGGATGGGGG - Intergenic
906560394 1:46752538-46752560 CAGTGTAATAAGAGCTATGGTGG + Intergenic
907838417 1:58133205-58133227 CAGGGGTATAAGATGCATGGTGG - Intronic
907933992 1:59025728-59025750 CATGTGAAGGAGAGGAATGGAGG - Intergenic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
909164518 1:72202253-72202275 GAGGGGAAAGATAGGTATGGAGG - Intronic
909169725 1:72280914-72280936 CAGGGAAATGTGAGGTGGGGTGG + Intronic
913442248 1:118910085-118910107 GAGGGGAATGAGAGGAAAGATGG - Intronic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
915365153 1:155310997-155311019 CAGGGGAATGAAGGGAAAGGGGG + Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
916493975 1:165328062-165328084 CAGTGGAAGGAGAGATAAGGAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
920370297 1:205474631-205474653 CAGGGGTTGGAGAGGGATGGGGG - Intergenic
920703260 1:208233632-208233654 CGAGGGAATGAGAGGCAGGGAGG - Intronic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921483368 1:215689036-215689058 CAAGGGAAAGAGAGGAATGAAGG + Intronic
922563667 1:226587282-226587304 CAGGAGACTGAGGGGGATGGAGG + Intronic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
1063210025 10:3871974-3871996 CAGAGGAGAGAGAGGAATGGGGG - Intergenic
1063849002 10:10163170-10163192 AAGGGGGATGTGAGGTACGGTGG + Intergenic
1063951460 10:11227038-11227060 CAGGGGAAGGGCAAGTATGGAGG + Intronic
1067415389 10:46098157-46098179 CAGGGGAGTGTGAAGTAGGGAGG + Intergenic
1068206102 10:53856121-53856143 CAGGGGAAAGGGTGGGATGGAGG + Intronic
1068732925 10:60379716-60379738 TAGGGGAAAGGGAGGTATAGAGG + Intronic
1069765942 10:70859925-70859947 TAGGGGAATGGTAGGTATGCAGG - Intronic
1069808853 10:71143767-71143789 CAGGGAAATGACTGGTATGCTGG - Intergenic
1072665322 10:97388488-97388510 CAGGAGATTGAGAAGTCTGGAGG - Exonic
1073012555 10:100372916-100372938 CAGGGGAAAGAGAAGTCTGTGGG - Intergenic
1074956343 10:118394400-118394422 TAGGGAAATGAGAGGTCTAGCGG - Intergenic
1075439744 10:122470360-122470382 CAGTGGCATAAGGGGTATGGAGG + Intronic
1075592570 10:123703231-123703253 CAGGGGAATGTGAAGAAAGGAGG + Intergenic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1076290430 10:129341485-129341507 CAGGGGACAGCGAGGTGTGGTGG - Intergenic
1076604252 10:131678831-131678853 CAGGAGAATGAGCGGCATGGGGG + Intergenic
1076713184 10:132350350-132350372 CAGGGTCCTGAGGGGTATGGAGG - Intronic
1077167551 11:1150611-1150633 TAGGGGAACCAGAGGCATGGGGG + Intergenic
1077531341 11:3097045-3097067 CAGGAGAAGGAGAGGAAAGGGGG + Intronic
1077700258 11:4434828-4434850 CAGGGGAATGAGGGGCATGAAGG - Intergenic
1078529694 11:12127470-12127492 CCAGGTGATGAGAGGTATGGTGG + Intronic
1079010219 11:16822036-16822058 CAGGGAAATGAGAGGTGGGTGGG - Intronic
1081583606 11:44369348-44369370 CAGGGGAATGGGACCTACGGTGG + Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1084948222 11:72650507-72650529 CGGGGGGATGAGAGATATAGTGG - Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085069625 11:73531733-73531755 AAGGGGAATGAAAGGCATTGTGG - Intronic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1089369474 11:117944800-117944822 CAGGCCAATAAGAGGTAGGGAGG + Intergenic
1090081771 11:123618404-123618426 CTGGGGGAAGAGAGGTACGGTGG - Intronic
1090251543 11:125255309-125255331 CAGGGAAATGAGGGGTCTTGAGG - Intronic
1091227248 11:133964990-133965012 TCCGGGAATGAGAGGTCTGGGGG - Intergenic
1092120544 12:6040713-6040735 CATGGGAATGAGGAGGATGGGGG - Intronic
1093706053 12:22276017-22276039 CAGGGGAATGATATGGAGGGAGG + Intronic
1093741463 12:22693707-22693729 CGGGGGAAAAAGAGGGATGGGGG - Intergenic
1094398295 12:30032611-30032633 GAAGGGAATGAGAGGTATGAAGG + Intergenic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1095613791 12:44164354-44164376 CAGGGGAAGGGGTGGGATGGTGG - Intronic
1096674824 12:53220895-53220917 CCTGGGAATGAGAGGGGTGGAGG - Intronic
1098352728 12:69581260-69581282 AAGGGGAATGACAGAAATGGAGG + Intergenic
1100464366 12:94832344-94832366 CAGGGGAATGAGAGTAAAGAAGG + Intergenic
1101532860 12:105590323-105590345 CAAGGGACTGGGAGGTATAGAGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1102634136 12:114308034-114308056 CAGGTGGATGAGGGGTAGGGTGG - Intergenic
1102687042 12:114732754-114732776 CAAGGAAATGAGAGGGCTGGGGG - Intergenic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1103493672 12:121344250-121344272 CTTAGTAATGAGAGGTATGGAGG + Intronic
1105012578 12:132765618-132765640 CAGGGGAATGAGGGGTTTCAGGG + Intergenic
1105296182 13:19089702-19089724 CAGGAGAATGGGGTGTATGGAGG - Intergenic
1105475577 13:20725669-20725691 CCTGGGAATGAAAGGCATGGAGG - Intergenic
1106339001 13:28810254-28810276 CAGAAGAAAGAGAGGTATGGGGG - Intergenic
1106450346 13:29875896-29875918 GAAGGGAATGTAAGGTATGGAGG - Intergenic
1106944044 13:34805560-34805582 CAGGGAAATGAGAAGAATGTTGG - Intergenic
1107445782 13:40469449-40469471 CAGGGGCATGAGAACTTTGGGGG + Intergenic
1107901352 13:45018044-45018066 TAGAGGTATGAGAGGTATGCTGG - Intronic
1108268372 13:48734369-48734391 CAGGGTACTGATAGGAATGGTGG + Intergenic
1110416899 13:75262835-75262857 TAGGGGAATCAGAAGTTTGGGGG - Intergenic
1112967377 13:105213116-105213138 CAGGGGAGAGAGACGGATGGGGG - Intergenic
1113061476 13:106326699-106326721 CAGGGAAATCAGAAGTATAGAGG + Intergenic
1113642661 13:111969398-111969420 CAGGAGAGTGAGGGCTATGGGGG - Intergenic
1113754832 13:112803973-112803995 GAGGGGAATGAGGGGAATGAGGG - Intronic
1114320020 14:21539457-21539479 GAGGGGAAGGAGAGGGATAGAGG + Intergenic
1115214203 14:30998367-30998389 CTGGGAAATGAGATGTATGCAGG + Intronic
1117842440 14:59873791-59873813 CAGGGGCCTGAGGGGCATGGAGG - Intergenic
1118257657 14:64219408-64219430 CAGGTGAGTTAGAGGTGTGGTGG + Exonic
1118400413 14:65374412-65374434 CAGGGGAAGTGGAGGTATAGAGG - Intergenic
1118904174 14:70011462-70011484 CTGGGAAAAGAGAGATATGGGGG - Intronic
1119052627 14:71384936-71384958 GTGGGGAATGAAAGGTATTGAGG + Intronic
1119935174 14:78585649-78585671 CTGGGGTATGAGAGGAAGGGAGG + Intronic
1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG + Intronic
1120964205 14:90153166-90153188 CAGGGGAAGGAGAGTCAGGGAGG - Intronic
1121492817 14:94372167-94372189 CAGGGGATGGAGAGAAATGGTGG - Intergenic
1121828150 14:97027560-97027582 CAGGGGAGTGTGTGGGATGGGGG + Intergenic
1122091294 14:99342738-99342760 TAGGGGAAAGGGAGGGATGGGGG - Intergenic
1124790193 15:32719170-32719192 CAGGGGAGTGGGAGGTATATTGG + Intronic
1125189018 15:36967828-36967850 CATGGGGAGGAGAGGTATAGAGG - Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125608178 15:40953834-40953856 CAGGGGAGTGAGGGGGTTGGGGG + Intronic
1126491423 15:49241089-49241111 CATTGGAATAAGAGATATGGGGG + Intronic
1127499767 15:59544945-59544967 CAGGGCACTGAGGGGTGTGGGGG + Intergenic
1127884957 15:63190264-63190286 CAGGGGAATGAGCGGTCAGGAGG + Intronic
1129319990 15:74769227-74769249 CTGGGGAATGAGAGGAAGTGGGG - Intergenic
1129907104 15:79196094-79196116 CAGGGGAATCACTGGAATGGTGG - Intergenic
1132198802 15:99933395-99933417 CTGGGGCATGAGAAGTTTGGGGG + Intergenic
1132749196 16:1449541-1449563 CAGGGGAGTGGCAGGCATGGAGG + Intronic
1133071109 16:3247255-3247277 CAGAGGACAGGGAGGTATGGGGG + Intronic
1134818969 16:17230129-17230151 CTGGAGAATGAGAGTTCTGGAGG - Intronic
1134842905 16:17415735-17415757 GATGGGGATGAGAGCTATGGAGG + Intronic
1134888188 16:17813626-17813648 CAGAGGAATCAGAGGCATAGAGG + Intergenic
1136655191 16:31705459-31705481 CAGTGGCCTGAGAGGTGTGGAGG + Intergenic
1138754009 16:59459927-59459949 CAAGGGAATGAGAAGTGCGGAGG + Intergenic
1140924719 16:79571227-79571249 CAGGGGGATGAGCGGGAGGGAGG + Intergenic
1141771622 16:86093142-86093164 CTGGGGAGTGAGTGGAATGGTGG - Intergenic
1141808472 16:86357979-86358001 GAGGGGAAAGAGGGGTAGGGGGG - Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1143461213 17:7105048-7105070 CATGGGAATAAGAGGTATCCTGG + Intronic
1144232424 17:13221205-13221227 GAGGGGAATGACAGGCACGGGGG + Intergenic
1144255014 17:13458964-13458986 GAGGAGAATGAGAAGAATGGAGG - Intergenic
1146455825 17:33009047-33009069 AAGGGGCATGAGAGGTAGGCAGG - Intergenic
1146790776 17:35749324-35749346 CTGGGGAATGAGAAGCAAGGAGG + Intronic
1146843890 17:36171796-36171818 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146856196 17:36259731-36259753 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146864423 17:36328644-36328666 GGGGTGAATGAGAGGGATGGGGG + Intronic
1146872103 17:36383642-36383664 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146879465 17:36434727-36434749 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146883390 17:36455870-36455892 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1147067281 17:37929232-37929254 GGGGTGAATGAGAGGGATGGGGG + Intronic
1147074989 17:37984266-37984288 GGGGTGAATGAGAGGGATGGGGG - Intronic
1147078814 17:38008793-38008815 GGGGTGAATGAGAGGGATGGGGG + Intronic
1147086514 17:38063812-38063834 GGGGTGAATGAGAGGGATGGGGG - Intronic
1147094751 17:38132728-38132750 GGGGTGAATGAGAGGGATGGGGG + Intergenic
1147102457 17:38187775-38187797 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1147523460 17:41197271-41197293 CAGGGGAAGGAGTGTGATGGGGG - Intronic
1147962063 17:44173820-44173842 AAGTGGGAAGAGAGGTATGGGGG + Intronic
1148568814 17:48650200-48650222 CTGGGGAAAGAGGGGAATGGGGG - Intergenic
1149847032 17:60014251-60014273 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1150085388 17:62270858-62270880 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1150707893 17:67504074-67504096 CAGAGAAATGAGGGGTGTGGAGG + Intronic
1151326646 17:73383834-73383856 CAGAGGAATGGGTGGGATGGGGG - Intronic
1151933577 17:77247987-77248009 AAGGGGGCTGAGAGCTATGGAGG + Intergenic
1152261656 17:79270469-79270491 CAGGAGAAGGGGAGGCATGGTGG - Intronic
1152501924 17:80717838-80717860 CAGGGGAATGCAAGGGAGGGCGG - Intronic
1153625670 18:7020312-7020334 CAAGTGAGTGAGAGTTATGGGGG + Intronic
1153784600 18:8523401-8523423 CAGGGGGATCAGAGATGTGGAGG + Intergenic
1155532374 18:26780361-26780383 CAGGGGAATCAAAGGTAAGGAGG - Intergenic
1157168042 18:45376397-45376419 CAGGGGAATGAGGGAAATGATGG + Intronic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1158664963 18:59424005-59424027 CAGGGGAAGAAGATGTCTGGAGG - Intergenic
1161430521 19:4229604-4229626 CAGTGGAAGGAAAGGTATGTGGG + Exonic
1161438556 19:4278470-4278492 GAGGGCACTGAGAGGTTTGGGGG - Intergenic
1161657154 19:5523345-5523367 CAGGGAAGTGGGAGCTATGGAGG - Intergenic
1161766505 19:6211665-6211687 CAGGGGGTTGAGAGGACTGGAGG + Intergenic
1162270215 19:9608239-9608261 GAGGGGAAGGAGAGAGATGGTGG + Exonic
1162974157 19:14198775-14198797 GAGGGGGAGGAGGGGTATGGTGG - Intronic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1164473615 19:28555751-28555773 CAGGGGCATAAGAGGACTGGGGG + Intergenic
1164616084 19:29667536-29667558 CAAGGGAATCAGAGTTCTGGGGG - Intronic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1164730398 19:30499868-30499890 CAGGGGCAAGGGAGGGATGGTGG + Intronic
1164752293 19:30665857-30665879 CAGAGGACTGAGAGGAAAGGAGG + Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1165845444 19:38815299-38815321 CATGGGAATGGGTGGCATGGAGG - Intergenic
1165988266 19:39789712-39789734 CAGGGGAAAGAATGGGATGGAGG + Intergenic
1166075523 19:40411749-40411771 CAGGGGAAAGAGGGGTGGGGAGG + Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166891546 19:45997047-45997069 CAGGGGAATGAGAGAAGTGATGG - Intronic
1166898502 19:46039959-46039981 GAGGGGAATAAGAGGGAGGGTGG + Intronic
925250040 2:2424754-2424776 GAGGGGATTGGGAGGTAGGGAGG + Intergenic
927561391 2:24076652-24076674 CAGGGTTATGACAGGTAGGGCGG + Intronic
928076730 2:28272015-28272037 GAGGGGAAGGAGAGTTATGTTGG + Intronic
928382833 2:30835121-30835143 CAGGGGCTTGAAAGCTATGGAGG - Intergenic
928722445 2:34135235-34135257 GAGGGGAATAAAAGGAATGGAGG - Intergenic
929116000 2:38444733-38444755 CCGTGGAATCAGAGCTATGGAGG + Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
930206259 2:48589062-48589084 AAGGGGAATGAGAGTGGTGGAGG + Intronic
930237520 2:48902334-48902356 CAGGCCAATGAGAGAAATGGGGG + Intergenic
930237717 2:48903714-48903736 CAGGCCAATGAGAGAAATGGGGG + Intergenic
930928278 2:56848212-56848234 CTGGGGACTGAGGGTTATGGAGG + Intergenic
931743929 2:65275084-65275106 CAGGAGTATGAGAGTTGTGGGGG - Intergenic
932570957 2:72938187-72938209 CAGGGGGAAGAGAGGCTTGGAGG - Intergenic
932777730 2:74538367-74538389 CTGGGGAATGAGGGCTATGAGGG + Intronic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
937815654 2:126247888-126247910 CAGGCAAATGACAGGCATGGAGG + Intergenic
940899709 2:159115395-159115417 CAGGGGAATGTGCAGTGTGGTGG + Intronic
942042003 2:172076025-172076047 CAGAGGAACGAGAGGTATGATGG + Intronic
942275125 2:174315833-174315855 CAGGGGAAAGAGTGGAAGGGGGG + Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
945253313 2:207782845-207782867 CAGGAGGATGAGAGATATGTCGG + Intergenic
946059991 2:216933538-216933560 GTGGGGAATGGGAGGCATGGAGG + Intergenic
946920857 2:224580926-224580948 CTGGGGAATGAAAGAAATGGGGG + Intronic
947223884 2:227821683-227821705 CAGGAGAATGGGAGGGCTGGAGG + Intergenic
947422130 2:229950492-229950514 GGGAGGAATGTGAGGTATGGAGG + Intronic
947593460 2:231397288-231397310 CAGGGAAATGAAAGGCATTGGGG + Intronic
948733162 2:239979980-239980002 CAGGGGAGTGAGGGATGTGGGGG - Intronic
948733176 2:239980022-239980044 CAGGGGACTGAGGGATGTGGGGG - Intronic
948902531 2:240963760-240963782 CAGGAGAAGGCCAGGTATGGCGG + Intronic
949008748 2:241666768-241666790 CAGGGGAATGAGAAGTACCAGGG - Exonic
1169838857 20:9911702-9911724 CAGGTGGATGAGAGGTTGGGAGG - Intergenic
1169879140 20:10328024-10328046 CTGGAGAATGAGAGGGATGTGGG - Intergenic
1170173928 20:13446092-13446114 CAGTTGTATGACAGGTATGGAGG + Intronic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1172634462 20:36400799-36400821 CAGGGGAATGGGAGTGAAGGAGG + Intronic
1173142206 20:40494337-40494359 CAGAGGAATGAAAGGGAGGGAGG - Intergenic
1174351265 20:49970075-49970097 CAGGTGAATGAGGGGGTTGGGGG - Intergenic
1174627569 20:51928013-51928035 CAGGGGAATTAGAAGTAAGGAGG + Intergenic
1175300271 20:57937970-57937992 CTGGGGCATGGGAGGTTTGGTGG + Intergenic
1175301806 20:57948256-57948278 CATGGGAATCAGGGGTGTGGGGG - Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1178602251 21:34004809-34004831 CAGTGGGAGGGGAGGTATGGGGG - Intergenic
1181496081 22:23288340-23288362 CAGGGGAACAAGAGGGCTGGGGG - Intronic
1182357126 22:29727270-29727292 GAGGGGGATGAAAGGAATGGGGG + Intronic
1183284749 22:36954817-36954839 CAGGGGAAGTAGAGGTGTGACGG - Intergenic
1183598627 22:38827100-38827122 CAGGGGAGGGACAGGTCTGGTGG - Intronic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
1184716136 22:46282842-46282864 CAGGGGAGTGGGTGGTATGTGGG - Intronic
1184846719 22:47092296-47092318 CACAGGACAGAGAGGTATGGAGG + Intronic
950142507 3:10625187-10625209 CAGGGGAATGAACGGTCTGTGGG + Intronic
950366909 3:12492930-12492952 CTGAGGAAAGAGAGGAATGGGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951529369 3:23684346-23684368 GGGTGGAATGGGAGGTATGGAGG - Intergenic
951997017 3:28742133-28742155 CAGATGAATGAGAGGTAAGTAGG + Intergenic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
954214311 3:49115952-49115974 AGGGGGAATGAGAGGGCTGGTGG + Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955251121 3:57283440-57283462 CTGGGAAATGAGAAGTGTGGTGG + Intronic
955487152 3:59446834-59446856 CAGGGAGATGGGAGGTAGGGAGG - Intergenic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956586835 3:70874296-70874318 CAGGGGCTAGAAAGGTATGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
957861000 3:85948973-85948995 CATGGAAATGTGAGGCATGGTGG + Intronic
959074324 3:101734256-101734278 CAGTGGAATGAGAGCTTTAGGGG + Intronic
961189680 3:124948088-124948110 CAAGGGATTGAGGGGCATGGGGG + Intronic
961397937 3:126610054-126610076 CAGGGCAGTGACAGGGATGGCGG - Intronic
961496641 3:127297724-127297746 CAGTGGTGTGAGAGGTGTGGGGG + Intergenic
961982196 3:131092054-131092076 CACAGGAATGCAAGGTATGGAGG + Intronic
962732882 3:138299549-138299571 CAGGGGAATGGGGTGTAAGGGGG - Intronic
963091102 3:141484895-141484917 AGGAGGAATGAGAGGGATGGGGG + Intergenic
965524627 3:169702694-169702716 CAAGGGAAAGAGAGGTGTGATGG - Intergenic
967245476 3:187482425-187482447 CAAGGGAAAGAGAGGTATCAAGG - Intergenic
968628333 4:1637905-1637927 CAGGTGGATGGGAGGAATGGGGG - Intronic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
969128589 4:4973770-4973792 CAGGGGAAAGAGAGAGACGGGGG - Intergenic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
969695132 4:8729890-8729912 CTGGGGCATGAGGGGCATGGGGG + Intergenic
969903400 4:10370903-10370925 CAGGTGAATCAGAGGTTGGGTGG - Intergenic
970225013 4:13848897-13848919 CAGGAGAAAGAGAGGCAGGGAGG - Intergenic
971303024 4:25457305-25457327 CAGGGGAAAAAGCGGTAAGGAGG - Intergenic
971359362 4:25922634-25922656 CTGGGGAATGAAATGTATGAAGG - Intronic
971395341 4:26221932-26221954 CAGGGCGGTGAGAGGGATGGGGG + Intronic
974107540 4:57487256-57487278 CAGGGGAATGTGAGGGTTGAGGG - Intergenic
976067477 4:81205116-81205138 GATAGGAATGAGAGGAATGGTGG - Intronic
976615098 4:87068536-87068558 CAGGGAGACGGGAGGTATGGAGG + Intronic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
978383437 4:108155289-108155311 AAAGGGAATGAGACGTATGAGGG - Intronic
978875940 4:113640044-113640066 CAAGGGAAGGAGAGGTAGAGAGG + Intronic
980542611 4:134213979-134214001 CTGGGGACTGAGAGGTTTTGAGG - Intergenic
980566108 4:134544564-134544586 CAGGAGAATGTGATTTATGGTGG + Intergenic
981572046 4:146162241-146162263 CAGGAGACAGAGAGGGATGGGGG - Intergenic
982453274 4:155577410-155577432 AAGGGGCAGGGGAGGTATGGAGG - Intergenic
983428497 4:167618470-167618492 CACGAGAATAAGTGGTATGGGGG - Intergenic
985297499 4:188451029-188451051 CAGGGAAATGGCAGGTTTGGAGG + Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986307930 5:6529243-6529265 CAGGGGAGTGGGTGGTGTGGTGG - Intergenic
986589935 5:9358130-9358152 TGATGGAATGAGAGGTATGGAGG - Intronic
988285748 5:29213909-29213931 CAGGGGCCAAAGAGGTATGGAGG - Intergenic
988487993 5:31682839-31682861 CAGGGGAAAGGGAGGGGTGGAGG - Intronic
988529417 5:32014620-32014642 CAGGGCCATGGGTGGTATGGGGG - Intronic
988926110 5:35992403-35992425 AAGGGGAAAGAGAAGTGTGGAGG + Intergenic
990439457 5:55830107-55830129 CAGGCGAGTGAGAGGGCTGGAGG + Intergenic
991085576 5:62645720-62645742 CAGGTGAATAAGAGGAAGGGAGG - Intergenic
991304158 5:65159081-65159103 CATGGAGATGAGAGATATGGAGG - Intronic
991522354 5:67515195-67515217 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
991619969 5:68534799-68534821 CACTGGAATGAGAGGTATGTGGG + Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
998148572 5:139744469-139744491 CGGGGGAATGAGGGGCATGGGGG - Intergenic
998352202 5:141508954-141508976 CAGCGGAATGAAAGGGCTGGGGG + Intronic
998375363 5:141687097-141687119 CAGAGGAATTAGGGGTAGGGAGG - Intergenic
999147961 5:149408133-149408155 CAGGGGACTTAGAGGAATGCAGG + Intergenic
999353761 5:150904546-150904568 CAGGGAAGTGAGAGGTGAGGGGG - Intronic
999427595 5:151501010-151501032 CAGGAGAATGGGAGGCAGGGAGG + Intergenic
999797905 5:155005242-155005264 CTGGGGAGTGAGAGGTAGGAGGG + Intergenic
1000649400 5:163797581-163797603 CGGGGGAAAGAGTGGCATGGGGG - Intergenic
1001225328 5:169940013-169940035 CTGGGGAATGGGAGGTGTTGGGG - Intronic
1001436803 5:171705512-171705534 CAGGGCAGTGGGAGGCATGGAGG + Intergenic
1002140007 5:177132788-177132810 AAGGGGAGGGAGAGGGATGGGGG + Intergenic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1003596161 6:7475994-7476016 CAGGTGAAGGAGAGATATTGGGG + Intergenic
1004012600 6:11703565-11703587 CAGGGGCATGGGTGTTATGGTGG - Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005068861 6:21845736-21845758 CAGGGGAAGGTGAGGGATGTGGG + Intergenic
1005847141 6:29790943-29790965 CTGAGGCATGAGAGGAATGGAGG + Intergenic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006377899 6:33681842-33681864 CAGGGCAATGAGGGTGATGGGGG + Intronic
1006913883 6:37582322-37582344 CAGGAGAGTCAGAGATATGGTGG + Intergenic
1008617093 6:53237141-53237163 GGGGGGAATGAGAAGGATGGAGG - Intergenic
1012291528 6:97461212-97461234 CTGTGGAGTGAGAGGTTTGGAGG + Intergenic
1013136884 6:107290829-107290851 CATGGCAATAAGAGCTATGGAGG - Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015802904 6:137078556-137078578 CAGGTGTTTGAGAGGTATGATGG - Intergenic
1016765203 6:147785157-147785179 CTGGAGAATAAGAGGTATGTGGG - Intergenic
1017473844 6:154767824-154767846 CAGGGGAAGGTCAGGCATGGTGG - Intronic
1017496514 6:154988399-154988421 CAGGAGAAAGAGAGATATGGGGG + Intronic
1018542563 6:164898236-164898258 CCGGCGAATGATAGGGATGGAGG - Intergenic
1018779480 6:167049372-167049394 CAGGGAGCTGAGAGGAATGGCGG - Exonic
1018990300 6:168669076-168669098 GAGGGGAATGTGAGGAGTGGGGG - Intronic
1019019220 6:168903374-168903396 CAGGTCAATGAAAGGTATGAAGG + Intergenic
1019289738 7:244589-244611 CAGGGCAGTGGCAGGTATGGCGG - Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1021312032 7:19107869-19107891 CCGGGGAATGGCAGGAATGGGGG + Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1023006119 7:35869197-35869219 CAGGGATATGAGAGGTAGAGAGG + Intronic
1024231592 7:47367671-47367693 GAGGGGACTGAGAGCTGTGGTGG - Intronic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1027488148 7:78787316-78787338 GATGGGGATGAGAAGTATGGAGG + Intronic
1027848566 7:83419039-83419061 GAGGGGGATGAGACGTAGGGGGG - Intronic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1028770715 7:94617507-94617529 CCGTGGAATGAGATGAATGGGGG - Intronic
1030962420 7:115943229-115943251 GAGGGGAATGAGTGGGATGGTGG + Intronic
1033143846 7:138853714-138853736 CAAGGGAAAGAGGGTTATGGAGG + Intronic
1033157754 7:138971331-138971353 CTGGGGACAGAGATGTATGGGGG - Intronic
1033478793 7:141717801-141717823 CAGGTGTAAGAGGGGTATGGTGG + Intronic
1033584255 7:142762539-142762561 CATGGGCAGGAGAGGGATGGGGG - Intronic
1034878918 7:154749067-154749089 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879035 7:154749688-154749710 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879044 7:154749740-154749762 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879053 7:154749792-154749814 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879071 7:154749895-154749917 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879080 7:154749947-154749969 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879089 7:154749999-154750021 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034932381 7:155172805-155172827 CAGGGGAAGCAGATGTGTGGAGG - Intergenic
1036967554 8:13317641-13317663 GAGGGGAATGAGGGGTAGGGAGG + Intronic
1037138982 8:15497116-15497138 AAGAGGAATAAAAGGTATGGTGG + Intronic
1037604099 8:20422935-20422957 CAAGGTAAAGAGAGGAATGGAGG - Intergenic
1037806674 8:22061699-22061721 CAGGTGAGTCAGAGGTTTGGAGG - Intronic
1037877387 8:22554683-22554705 CAGGAGGATGAAAGGGATGGAGG + Intronic
1038402855 8:27298564-27298586 CATGGGAATGAGAGAGAGGGAGG + Intronic
1038409848 8:27349589-27349611 CAGGGGAATGAAAGGAATCTCGG - Intronic
1038605114 8:28993879-28993901 CAGGGGAAGGCCAGGCATGGTGG + Intronic
1040073487 8:43206755-43206777 TAGGGGAATGACAGAGATGGGGG - Intergenic
1040355736 8:46616999-46617021 CAGAGGAGTGAGAGGAAAGGAGG + Intergenic
1043075654 8:75695535-75695557 CATGGGAATGGGAGGCATGGAGG - Intergenic
1044434962 8:92151025-92151047 GAGGAGAATGAGAGGTATCAGGG + Intergenic
1047336427 8:123940890-123940912 GAGGGGAAGGAAAGGCATGGAGG + Intronic
1047361020 8:124169545-124169567 CAAGGGGTTGAGAGGTTTGGGGG - Intergenic
1047853933 8:128889483-128889505 AAGGGTAATGAGAGTTATGTTGG + Intergenic
1047990809 8:130284488-130284510 CAGGGGAAAGTGAGCTATGAGGG + Intronic
1048041150 8:130729851-130729873 CAGGGAAATGAGAAGCATAGAGG + Intergenic
1048309027 8:133304001-133304023 CAGGAGAATGAGAGGTTAGCTGG - Intergenic
1048884898 8:138902077-138902099 CAGGGGAGGAAGAGGCATGGGGG + Intronic
1049222038 8:141432730-141432752 CGGGGGAATGGGGGGCATGGAGG + Intergenic
1049684361 8:143933463-143933485 AAGGGGAAGGACAGGGATGGAGG - Intronic
1049969410 9:808150-808172 AAGGGGAATGAGAGGTGAGATGG + Intergenic
1051235267 9:14992885-14992907 TAGGGGAGGGAGAGGGATGGAGG + Intergenic
1051504450 9:17812169-17812191 CAGGGGTGTGAGGGGCATGGTGG + Intergenic
1051909066 9:22132247-22132269 CAGGGTAATGAAAAGTACGGAGG - Intergenic
1051919928 9:22252555-22252577 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
1052352986 9:27476073-27476095 TAGGGGAAGGAGAGGTATCCAGG - Intronic
1052664255 9:31474019-31474041 GAGAGGAATGAGGGGTAGGGAGG + Intergenic
1052768843 9:32668988-32669010 CACGGGAATGAGGGCGATGGTGG - Intergenic
1053111027 9:35460428-35460450 GAGGGGAAAGAGAGGTGTGTGGG - Intergenic
1053111043 9:35460496-35460518 GAGGGGAAAGAGAGGTGTGTGGG - Intergenic
1053146118 9:35713195-35713217 CAGGGCAATGAGAATTATGCAGG - Exonic
1054742769 9:68825515-68825537 AAAGGGAATAAGATGTATGGTGG - Intronic
1054858422 9:69925577-69925599 AAGGGGAATGTGAGGTACAGTGG + Intergenic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1055497308 9:76868449-76868471 CAGGGGATTGCTAGGGATGGTGG - Intronic
1055517390 9:77047126-77047148 CAGGGAAAGGAAAAGTATGGAGG - Intergenic
1056510892 9:87304613-87304635 CCGGGGAGAGAGAGGAATGGAGG + Intergenic
1057568220 9:96183790-96183812 CAGAGGAAGAAGAGGTATCGTGG - Intergenic
1060055337 9:120408338-120408360 CAGGAGACTGAGAGGTACTGAGG - Exonic
1060768809 9:126315216-126315238 CAGGAGGATGAGAGGTTTGCTGG - Intergenic
1061722343 9:132560321-132560343 CAGGTGAATGAGAGTTGTAGTGG - Intronic
1061942784 9:133892083-133892105 AGGGGGAAGGAGAGGGATGGGGG + Intronic
1061994498 9:134176886-134176908 GAGGGGAAGGAGAGACATGGGGG - Intergenic
1062047888 9:134432796-134432818 CAGGGGAGTGAGAGGCACGGAGG + Intronic
1062277762 9:135738820-135738842 CAGGGGAGTGAGAAGGAAGGAGG - Intronic
1062548916 9:137077212-137077234 CAGGGGACGGAGAGGGACGGGGG + Intergenic
1062716668 9:138013984-138014006 ATGGGGAATGGGAGGTGTGGGGG - Intronic
1186579569 X:10803024-10803046 TAGGGGAGAGAGAGGGATGGGGG + Intronic
1186747154 X:12581938-12581960 GAGGCTAATGAGAAGTATGGAGG - Intronic
1186751835 X:12629316-12629338 TAAAGGAATGAAAGGTATGGGGG + Intronic
1190066672 X:47246089-47246111 GAGGGGATGGAGAGGGATGGTGG - Intronic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1190107239 X:47569440-47569462 CAGAGGGATGAGTGGTATAGGGG + Intronic
1190264902 X:48822584-48822606 AAGGGGAGGGAAAGGTATGGTGG - Intronic
1191001185 X:55661169-55661191 CAGGGGAAAGGGTGGGATGGGGG + Intergenic
1192331037 X:70175443-70175465 CAGGGAAAGCAGAGATATGGAGG - Intergenic
1192436154 X:71145065-71145087 CATGGGGTTGAGAGGGATGGGGG - Intronic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1194051038 X:89069496-89069518 AAGGGGAAGAAGAGGTATTGAGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194280073 X:91940162-91940184 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1197981989 X:132226955-132226977 CTGGGGAATGAGAAGTTTGGAGG + Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1199680307 X:150219895-150219917 CTGGGGAATGACAGGGATAGGGG - Intergenic
1200153832 X:153964767-153964789 TTGGGGAATGAGAGGAATGGGGG - Intronic
1200597548 Y:5163663-5163685 CAGGAGCAAGAGAGGCATGGGGG - Intronic