ID: 936607988

View in Genome Browser
Species Human (GRCh38)
Location 2:113976685-113976707
Sequence CTCCCTAACCAAAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936607988_936607996 30 Left 936607988 2:113976685-113976707 CCAACTTCCTTTTGGTTAGGGAG No data
Right 936607996 2:113976738-113976760 TCCACAAACCGTTTACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936607988 Original CRISPR CTCCCTAACCAAAAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr