ID: 936608239

View in Genome Browser
Species Human (GRCh38)
Location 2:113978377-113978399
Sequence TCACCCTCCCTAGCCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936608239_936608245 17 Left 936608239 2:113978377-113978399 CCTGTGTGGGCTAGGGAGGGTGA No data
Right 936608245 2:113978417-113978439 GTGACCACCTTGTCCTGGTTTGG No data
936608239_936608242 -5 Left 936608239 2:113978377-113978399 CCTGTGTGGGCTAGGGAGGGTGA No data
Right 936608242 2:113978395-113978417 GGTGACTGATGTTCACCGTGGGG No data
936608239_936608240 -7 Left 936608239 2:113978377-113978399 CCTGTGTGGGCTAGGGAGGGTGA No data
Right 936608240 2:113978393-113978415 AGGGTGACTGATGTTCACCGTGG No data
936608239_936608244 12 Left 936608239 2:113978377-113978399 CCTGTGTGGGCTAGGGAGGGTGA No data
Right 936608244 2:113978412-113978434 GTGGGGTGACCACCTTGTCCTGG No data
936608239_936608241 -6 Left 936608239 2:113978377-113978399 CCTGTGTGGGCTAGGGAGGGTGA No data
Right 936608241 2:113978394-113978416 GGGTGACTGATGTTCACCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936608239 Original CRISPR TCACCCTCCCTAGCCCACAC AGG (reversed) Intergenic
No off target data available for this crispr