ID: 936611082

View in Genome Browser
Species Human (GRCh38)
Location 2:114002630-114002652
Sequence CAATAGGTCTGGAGTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936611077_936611082 25 Left 936611077 2:114002582-114002604 CCTAAAATTAACCAGAGATCTGG No data
Right 936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG No data
936611079_936611082 14 Left 936611079 2:114002593-114002615 CCAGAGATCTGGTTATAGAGAAG No data
Right 936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936611082 Original CRISPR CAATAGGTCTGGAGTGTAGT TGG Intergenic
No off target data available for this crispr