ID: 936629124

View in Genome Browser
Species Human (GRCh38)
Location 2:114181426-114181448
Sequence GGTCCTATTAGGTTTAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936629124_936629129 11 Left 936629124 2:114181426-114181448 CCACCTTTAAACCTAATAGGACC No data
Right 936629129 2:114181460-114181482 AATGTGCTTCATATGTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936629124 Original CRISPR GGTCCTATTAGGTTTAAAGG TGG (reversed) Intergenic
No off target data available for this crispr