ID: 936631006

View in Genome Browser
Species Human (GRCh38)
Location 2:114202630-114202652
Sequence AAAAGTGAACAGGGCCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936631006_936631011 8 Left 936631006 2:114202630-114202652 CCCTTAAGGCCCTGTTCACTTTT No data
Right 936631011 2:114202661-114202683 TAAATGATGCATTTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936631006 Original CRISPR AAAAGTGAACAGGGCCTTAA GGG (reversed) Intergenic
No off target data available for this crispr