ID: 936631011

View in Genome Browser
Species Human (GRCh38)
Location 2:114202661-114202683
Sequence TAAATGATGCATTTCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936631009_936631011 -1 Left 936631009 2:114202639-114202661 CCCTGTTCACTTTTAGGAGCTAT No data
Right 936631011 2:114202661-114202683 TAAATGATGCATTTCAGAGCTGG No data
936631006_936631011 8 Left 936631006 2:114202630-114202652 CCCTTAAGGCCCTGTTCACTTTT No data
Right 936631011 2:114202661-114202683 TAAATGATGCATTTCAGAGCTGG No data
936631010_936631011 -2 Left 936631010 2:114202640-114202662 CCTGTTCACTTTTAGGAGCTATA No data
Right 936631011 2:114202661-114202683 TAAATGATGCATTTCAGAGCTGG No data
936631007_936631011 7 Left 936631007 2:114202631-114202653 CCTTAAGGCCCTGTTCACTTTTA No data
Right 936631011 2:114202661-114202683 TAAATGATGCATTTCAGAGCTGG No data
936631005_936631011 9 Left 936631005 2:114202629-114202651 CCCCTTAAGGCCCTGTTCACTTT No data
Right 936631011 2:114202661-114202683 TAAATGATGCATTTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936631011 Original CRISPR TAAATGATGCATTTCAGAGC TGG Intergenic
No off target data available for this crispr