ID: 936636262

View in Genome Browser
Species Human (GRCh38)
Location 2:114262005-114262027
Sequence GACTGTATACATTTAACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936636260_936636262 -7 Left 936636260 2:114261989-114262011 CCTTGTGTCTTCCATAGACTGTA No data
Right 936636262 2:114262005-114262027 GACTGTATACATTTAACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936636262 Original CRISPR GACTGTATACATTTAACATA TGG Intergenic
No off target data available for this crispr